EMAIL THIS PAGE TO A FRIEND

DMRT1

doublesex and mab-3 related transcription factor 1

72 Gene Product Result for
Synonyms: DMT1
UniProtKB ID: Q9Y5R6, B2R913, Q6T1H8, Q6T1H9, Q8IW77
Gene ID:
Human(1761) Summary: This gene is found in a cluster with two other members of the gene family, having in common a zinc finger-like DNA-binding motif (DM domain). The DM domain is an ancient, conserved component of the vertebrate sex-determining pathway that is also a key regulator of male development in flies and nematodes. This gene exhibits a gonad-specific and sexually dimorphic expression pattern. Defective testicular development and XY feminization occur when this gene is hemizygous. [provided by RefSeq, Jul 2008]
Mouse(50796) doublesex and mab-3 related transcription factor 1
Rat(114498) doublesex and mab-3 related transcription factor 1
Zebrafish(402923) doublesex and mab-3 related transcription factor 1
dog(609186) doublesex and mab-3 related transcription factor 1
chicken(769693) doublesex and mab-3 related transcription factor 1
domestic cat(101083884) doublesex and mab-3 related transcription factor 1
cow(616245) doublesex and mab-3 related transcription factor 1
domestic guinea pig(100726763) doublesex and mab-3 related transcription factor 1
naked mole-rat(101704400) doublesex and mab-3 related transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021951 Rosetta Predictions human pricing
NM_053706 Rosetta Predictions rat pricing
NM_015826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077998 predicted 1417
2 SASI_Hs01_00077999 predicted 771
3 SASI_Hs01_00078001 predicted 807
4 SASI_Hs01_00078003 predicted 1341
5 SASI_Hs02_00355276 predicted 986
6 SASI_Hs01_00078004 predicted 929
7 SASI_Hs01_00078005 predicted 1360
8 SASI_Hs01_00078006 predicted 686
9 SASI_Hs01_00078007 predicted 1187
10 SASI_Hs02_00355277 predicted 820
11 SASI_Hs01_00078000 predicted 1303
12 SASI_Hs01_00078002 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070638 predicted 1186
2 SASI_Rn02_00266475 predicted 513
3 SASI_Rn01_00070640 predicted 745
4 SASI_Rn01_00070641 predicted 867
5 SASI_Rn01_00070642 predicted 1128
6 SASI_Rn01_00070643 predicted 690
7 SASI_Rn01_00070644 predicted 631
8 SASI_Rn01_00070645 predicted 410
9 SASI_Rn01_00070646 predicted 1135
10 SASI_Rn02_00266476 predicted 624
11 SASI_Rn01_00070637 predicted 1036
12 SASI_Rn01_00070639 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323244 predicted 1292
2 SASI_Mm01_00194569 predicted 1232
3 SASI_Mm01_00194570 predicted 429
4 SASI_Mm02_00323245 predicted 1295
5 SASI_Mm01_00194572 predicted 797
6 SASI_Mm01_00194573 predicted 1176
7 SASI_Mm01_00194575 predicted 684
8 SASI_Mm01_00194576 predicted 733
9 SASI_Mm01_00194577 predicted 450
10 SASI_Mm01_00194578 predicted 737
11 SASI_Mm01_00194571 predicted 1092
12 SASI_Mm01_00194574 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015826
DMRT1 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1385s21c1
Sequence:CCGGTCATGTTAGAGTTAGGTTAAACTCGAGTTTAACCTAACTCTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1592s21c1
Sequence:CCGGGTATGCCCAAGTTACAATTACCTCGAGGTAATTGTAACTTGGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015826.2-1312s1c1
Sequence:CCGGCGGCAGGGTTTGTTGTTATTTCTCGAGAAATAACAACAAACCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-689s1c1
Sequence:CCGGCGCATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-764s1c1
Sequence:CCGGCCCGCCTACTACAGCAGCTTTCTCGAGAAAGCTGCTGTAGTAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-222s1c1
Sequence:CCGGCGCAGGGCAAAGCCGGAGGTTCTCGAGAACCTCCGGCTTTGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-790s1c1
Sequence:CCGGGCCTTCTCTGTTTCCTTACTACTCGAGTAGTAAGGAAACAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015826
DMRT1 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1385s21c1
Sequence:CCGGTCATGTTAGAGTTAGGTTAAACTCGAGTTTAACCTAACTCTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1592s21c1
Sequence:CCGGGTATGCCCAAGTTACAATTACCTCGAGGTAATTGTAACTTGGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015826.2-1312s1c1
Sequence:CCGGCGGCAGGGTTTGTTGTTATTTCTCGAGAAATAACAACAAACCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-689s1c1
Sequence:CCGGCGCATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-764s1c1
Sequence:CCGGCCCGCCTACTACAGCAGCTTTCTCGAGAAAGCTGCTGTAGTAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-222s1c1
Sequence:CCGGCGCAGGGCAAAGCCGGAGGTTCTCGAGAACCTCCGGCTTTGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-790s1c1
Sequence:CCGGGCCTTCTCTGTTTCCTTACTACTCGAGTAGTAAGGAAACAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015826
DMRT1 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1385s21c1
Sequence:CCGGTCATGTTAGAGTTAGGTTAAACTCGAGTTTAACCTAACTCTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015826.5-1592s21c1
Sequence:CCGGGTATGCCCAAGTTACAATTACCTCGAGGTAATTGTAACTTGGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015826.2-1312s1c1
Sequence:CCGGCGGCAGGGTTTGTTGTTATTTCTCGAGAAATAACAACAAACCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-689s1c1
Sequence:CCGGCGCATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-764s1c1
Sequence:CCGGCCCGCCTACTACAGCAGCTTTCTCGAGAAAGCTGCTGTAGTAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-222s1c1
Sequence:CCGGCGCAGGGCAAAGCCGGAGGTTCTCGAGAACCTCCGGCTTTGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015826.2-790s1c1
Sequence:CCGGGCCTTCTCTGTTTCCTTACTACTCGAGTAGTAAGGAAACAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021951
DMRT1 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1756s21c1
Sequence:CCGGAGTCTGCTAAATGGATATATTCTCGAGAATATATCCATTTAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1472s21c1
Sequence:CCGGGTGCTTTACTCACGGAGTTTACTCGAGTAAACTCCGTGAGTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021951.1-1580s1c1
Sequence:CCGGCCTCTAAATGAGTCATCTAATCTCGAGATTAGATGACTCATTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-794s1c1
Sequence:CCGGGCCGTCTCTGTTTCCTTATTACTCGAGTAATAAGGAAACAGAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1135s1c1
Sequence:CCGGGTCAAGATTCTGGCTTGGTTTCTCGAGAAACCAAGCCAGAATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1162s1c1
Sequence:CCGGCGAGCAGCTCTCCTATTAGTACTCGAGTACTAATAGGAGAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-693s1c1
Sequence:CCGGCGTATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021951
DMRT1 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1756s21c1
Sequence:CCGGAGTCTGCTAAATGGATATATTCTCGAGAATATATCCATTTAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1472s21c1
Sequence:CCGGGTGCTTTACTCACGGAGTTTACTCGAGTAAACTCCGTGAGTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021951.1-1580s1c1
Sequence:CCGGCCTCTAAATGAGTCATCTAATCTCGAGATTAGATGACTCATTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-794s1c1
Sequence:CCGGGCCGTCTCTGTTTCCTTATTACTCGAGTAATAAGGAAACAGAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1135s1c1
Sequence:CCGGGTCAAGATTCTGGCTTGGTTTCTCGAGAAACCAAGCCAGAATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1162s1c1
Sequence:CCGGCGAGCAGCTCTCCTATTAGTACTCGAGTACTAATAGGAGAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-693s1c1
Sequence:CCGGCGTATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021951
DMRT1 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1756s21c1
Sequence:CCGGAGTCTGCTAAATGGATATATTCTCGAGAATATATCCATTTAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021951.2-1472s21c1
Sequence:CCGGGTGCTTTACTCACGGAGTTTACTCGAGTAAACTCCGTGAGTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021951.1-1580s1c1
Sequence:CCGGCCTCTAAATGAGTCATCTAATCTCGAGATTAGATGACTCATTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-794s1c1
Sequence:CCGGGCCGTCTCTGTTTCCTTATTACTCGAGTAATAAGGAAACAGAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1135s1c1
Sequence:CCGGGTCAAGATTCTGGCTTGGTTTCTCGAGAAACCAAGCCAGAATCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-1162s1c1
Sequence:CCGGCGAGCAGCTCTCCTATTAGTACTCGAGTACTAATAGGAGAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021951.1-693s1c1
Sequence:CCGGCGTATGGTCATCCAGGATATTCTCGAGAATATCCTGGATGACCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks