EMAIL THIS PAGE TO A FRIEND

DMRT2

doublesex and mab-3 related transcription factor 2

169 Gene Product Result for
UniProtKB ID: Q9Y5R5, B1ANC0, B9EGJ1, Q9NPG6, Q9NQR6
Gene ID:
Human(10655) Summary: The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
Mouse(226049) doublesex and mab-3 related transcription factor 2
Rat(309430) doublesex and mab-3 related transcription factor 2
chicken(100858556) doublesex and mab-3 related transcription factor 2
cow(514435) doublesex and mab-3 related transcription factor 2
domestic cat(101083374) doublesex and mab-3 related transcription factor 2
naked mole-rat(101705079) doublesex and mab-3 related transcription factor 2
domestic guinea pig(100723101) doublesex and mab-3 related transcription factor 2
sheep(101110302) doublesex and mab-3 related transcription factor 2
Domestic Rabbit(100339283) doublesex and mab-3 related transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006557 Rosetta Predictions human pricing
NM_181872 Rosetta Predictions human pricing
NM_001107597 Rosetta Predictions rat pricing
NM_145831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115525 predicted 848
2 SASI_Hs01_00115526 predicted 1218
3 SASI_Hs01_00115528 predicted 1211
4 SASI_Hs01_00115529 predicted 974
5 SASI_Hs01_00115530 predicted 849
6 SASI_Hs02_00341826 predicted 849
7 SASI_Hs01_00115531 predicted 1303
8 SASI_Hs02_00341827 predicted 1260
9 SASI_Hs01_00115532 predicted 1345
10 SASI_Hs02_00341828 predicted 1246
11 SASI_Hs01_00115527 predicted 1027
12 SASI_Hs01_00115533 predicted 1014
13 SASI_Hs01_00115534 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151562 predicted 1168
2 SASI_Hs01_00151564 predicted 929
3 SASI_Hs01_00151566 predicted 1527
4 SASI_Hs01_00151567 predicted 1409
5 SASI_Hs01_00151568 predicted 1430
6 SASI_Hs02_00370467 predicted 1077
7 SASI_Hs01_00151569 predicted 1714
8 SASI_Hs01_00151570 predicted 978
9 SASI_Hs01_00151571 predicted 1344
10 SASI_Hs02_00370468 predicted 1627
11 SASI_Hs01_00151563 predicted 952
12 SASI_Hs01_00151565 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230405 predicted 1961
2 SASI_Rn02_00230406 predicted 1324
3 SASI_Rn02_00230407 predicted 1777
4 SASI_Rn02_00230408 predicted 1719
5 SASI_Rn02_00230409 predicted 1308
6 SASI_Rn02_00230410 predicted 1764
7 SASI_Rn02_00230411 predicted 1440
8 SASI_Rn02_00230412 predicted 1009
9 SASI_Rn02_00230413 predicted 1972
10 SASI_Rn02_00230414 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341297 predicted 1454
2 SASI_Mm01_00191012 predicted 1342
3 SASI_Mm02_00341298 predicted 1313
4 SASI_Mm01_00191013 predicted 1779
5 SASI_Mm01_00191014 predicted 1323
6 SASI_Mm01_00191015 predicted 1452
7 SASI_Mm01_00191017 predicted 1753
8 SASI_Mm01_00191018 predicted 1684
9 SASI_Mm01_00191019 predicted 1222
10 SASI_Mm01_00191020 predicted 1617
11 SASI_Mm01_00191016 predicted 1732
12 SASI_Mm01_00191021 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145831
DMRT2 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145831.1-2078s1c1
Sequence:CCGGGCTTACAAGGGAAGCTGGATTCTCGAGAATCCAGCTTCCCTTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1838s1c1
Sequence:CCGGCCTGAGTTGAACGCACCATTTCTCGAGAAATGGTGCGTTCAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-2013s1c1
Sequence:CCGGTCTCTGTCGAATCTATTCTTACTCGAGTAAGAATAGATTCGACAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1967s1c1
Sequence:CCGGGCCAAACAAGTTGGAACGAAACTCGAGTTTCGTTCCAACTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1370s1c1
Sequence:CCGGGCCACAACTTACAGACAATATCTCGAGATATTGTCTGTAAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1912s21c1
Sequence:CCGGGAGAGCCAGAAGTACACATTTCTCGAGAAATGTGTACTTCTGGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1811s21c1
Sequence:CCGGAGCAGACGCTCAGCGACAAATCTCGAGATTTGTCGCTGAGCGTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1788s21c1
Sequence:CCGGTAATCCATTCCACTCAGTATTCTCGAGAATACTGAGTGGAATGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145831
DMRT2 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145831.1-2078s1c1
Sequence:CCGGGCTTACAAGGGAAGCTGGATTCTCGAGAATCCAGCTTCCCTTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1838s1c1
Sequence:CCGGCCTGAGTTGAACGCACCATTTCTCGAGAAATGGTGCGTTCAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-2013s1c1
Sequence:CCGGTCTCTGTCGAATCTATTCTTACTCGAGTAAGAATAGATTCGACAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1967s1c1
Sequence:CCGGGCCAAACAAGTTGGAACGAAACTCGAGTTTCGTTCCAACTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1370s1c1
Sequence:CCGGGCCACAACTTACAGACAATATCTCGAGATATTGTCTGTAAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1912s21c1
Sequence:CCGGGAGAGCCAGAAGTACACATTTCTCGAGAAATGTGTACTTCTGGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1811s21c1
Sequence:CCGGAGCAGACGCTCAGCGACAAATCTCGAGATTTGTCGCTGAGCGTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1788s21c1
Sequence:CCGGTAATCCATTCCACTCAGTATTCTCGAGAATACTGAGTGGAATGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145831
DMRT2 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145831.1-2078s1c1
Sequence:CCGGGCTTACAAGGGAAGCTGGATTCTCGAGAATCCAGCTTCCCTTGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1838s1c1
Sequence:CCGGCCTGAGTTGAACGCACCATTTCTCGAGAAATGGTGCGTTCAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-2013s1c1
Sequence:CCGGTCTCTGTCGAATCTATTCTTACTCGAGTAAGAATAGATTCGACAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1967s1c1
Sequence:CCGGGCCAAACAAGTTGGAACGAAACTCGAGTTTCGTTCCAACTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145831.1-1370s1c1
Sequence:CCGGGCCACAACTTACAGACAATATCTCGAGATATTGTCTGTAAGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1912s21c1
Sequence:CCGGGAGAGCCAGAAGTACACATTTCTCGAGAAATGTGTACTTCTGGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1811s21c1
Sequence:CCGGAGCAGACGCTCAGCGACAAATCTCGAGATTTGTCGCTGAGCGTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145831.3-1788s21c1
Sequence:CCGGTAATCCATTCCACTCAGTATTCTCGAGAATACTGAGTGGAATGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006557
DMRT2 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006557.3-1792s1c1
Sequence:CCGGCGACGGAATTTCTCTCCCATTCTCGAGAATGGGAGAGAAATTCCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-633s1c1
Sequence:CCGGCCTTGGATTATTCTACAGCTACTCGAGTAGCTGTAGAATAATCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-658s1c1
Sequence:CCGGGTGTACATAATGAACCATCTTCTCGAGAAGATGGTTCATTATGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-133s1c1
Sequence:CCGGGACTGCGAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTCGCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-550s1c1
Sequence:CCGGCAGAATAATTTCGAGCGCAAACTCGAGTTTGCGCTCGAAATTATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1117s21c1
Sequence:CCGGAGAAGTTGCAGTATGGATATCCTCGAGGATATCCATACTGCAACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-775s21c1
Sequence:CCGGTGTACCAGAGGCAAGTCAGAGCTCGAGCTCTGACTTGCCTCTGGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1278s21c1
Sequence:CCGGCCGTAGATGTTAATCTCTTTCCTCGAGGAAAGAGATTAACATCTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-235s21c1
Sequence:CCGGACTGGGAGATCGATGTCGAGACTCGAGTCTCGACATCGATCTCCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006557
DMRT2 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006557.3-1792s1c1
Sequence:CCGGCGACGGAATTTCTCTCCCATTCTCGAGAATGGGAGAGAAATTCCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-633s1c1
Sequence:CCGGCCTTGGATTATTCTACAGCTACTCGAGTAGCTGTAGAATAATCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-658s1c1
Sequence:CCGGGTGTACATAATGAACCATCTTCTCGAGAAGATGGTTCATTATGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-133s1c1
Sequence:CCGGGACTGCGAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTCGCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-550s1c1
Sequence:CCGGCAGAATAATTTCGAGCGCAAACTCGAGTTTGCGCTCGAAATTATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1117s21c1
Sequence:CCGGAGAAGTTGCAGTATGGATATCCTCGAGGATATCCATACTGCAACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-775s21c1
Sequence:CCGGTGTACCAGAGGCAAGTCAGAGCTCGAGCTCTGACTTGCCTCTGGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1278s21c1
Sequence:CCGGCCGTAGATGTTAATCTCTTTCCTCGAGGAAAGAGATTAACATCTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-235s21c1
Sequence:CCGGACTGGGAGATCGATGTCGAGACTCGAGTCTCGACATCGATCTCCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006557
DMRT2 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006557.3-1792s1c1
Sequence:CCGGCGACGGAATTTCTCTCCCATTCTCGAGAATGGGAGAGAAATTCCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-633s1c1
Sequence:CCGGCCTTGGATTATTCTACAGCTACTCGAGTAGCTGTAGAATAATCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-658s1c1
Sequence:CCGGGTGTACATAATGAACCATCTTCTCGAGAAGATGGTTCATTATGTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-133s1c1
Sequence:CCGGGACTGCGAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTCGCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006557.3-550s1c1
Sequence:CCGGCAGAATAATTTCGAGCGCAAACTCGAGTTTGCGCTCGAAATTATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1117s21c1
Sequence:CCGGAGAAGTTGCAGTATGGATATCCTCGAGGATATCCATACTGCAACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-775s21c1
Sequence:CCGGTGTACCAGAGGCAAGTCAGAGCTCGAGCTCTGACTTGCCTCTGGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006557.5-1278s21c1
Sequence:CCGGCCGTAGATGTTAATCTCTTTCCTCGAGGAAAGAGATTAACATCTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006557.5-235s21c1
Sequence:CCGGACTGGGAGATCGATGTCGAGACTCGAGTCTCGACATCGATCTCCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)