EMAIL THIS PAGE TO A FRIEND

DMRTA1

DMRT-like family A1

50 Gene Product Result for
Synonyms: DMO DMRT4
UniProtKB ID: Q5VZB9, A1L481, Q8N8Y9, Q9H4B9
Gene ID:
Mouse(242523) doublesex and mab-3 related transcription factor like family A1
Rat(313352) DMRT-like family A1
cow(527219) DMRT-like family A1
dog(481564) DMRT-like family A1
domestic cat(101089472) DMRT-like family A1
naked mole-rat(101702467) DMRT-like family A1
domestic guinea pig(100733078) DMRT-like family A1
sheep(101107414) DMRT-like family A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022160 Rosetta Predictions human pricing
NM_001107945 Rosetta Predictions rat pricing
NM_175647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139423 predicted 899
2 SASI_Hs01_00139426 predicted 1540
3 SASI_Hs01_00139427 predicted 979
4 SASI_Hs01_00139428 predicted 1100
5 SASI_Hs02_00355591 predicted 1255
6 SASI_Hs01_00139429 predicted 1031
7 SASI_Hs02_00355592 predicted 1004
8 SASI_Hs01_00139430 predicted 956
9 SASI_Hs01_00139431 predicted 1138
10 SASI_Hs01_00139432 predicted 1516
11 SASI_Hs01_00139424 predicted 1531
12 SASI_Hs01_00139425 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233835 predicted 1266
2 SASI_Rn02_00233836 predicted 1218
3 SASI_Rn02_00233837 predicted 1373
4 SASI_Rn02_00233838 predicted 845
5 SASI_Rn02_00233839 predicted 2052
6 SASI_Rn02_00233840 predicted 1137
7 SASI_Rn02_00233841 predicted 1337
8 SASI_Rn02_00233842 predicted 738
9 SASI_Rn02_00233843 predicted 1095
10 SASI_Rn02_00233844 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201130 predicted 1124
2 SASI_Mm01_00201131 predicted 1264
3 SASI_Mm01_00201132 predicted 877
4 SASI_Mm01_00201133 predicted 751
5 SASI_Mm01_00201134 predicted 713
6 SASI_Mm01_00201135 predicted 744
7 SASI_Mm01_00201136 predicted 1224
8 SASI_Mm01_00201137 predicted 805
9 SASI_Mm01_00201138 predicted 1336
10 SASI_Mm01_00201139 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175647
DMRTA1 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family A1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1471s1c1
Sequence:CCGGCCAACTTTGGATTATGCGTTTCTCGAGAAACGCATAATCCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175647.2-2071s1c1
Sequence:CCGGCCAGAAATTGTTCCAAGTATTCTCGAGAATACTTGGAACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1259s1c1
Sequence:CCGGGCATTGGCTTTGGGACTCTAACTCGAGTTAGAGTCCCAAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-717s1c1
Sequence:CCGGGCAAGATTATGCTGACAGAAACTCGAGTTTCTGTCAGCATAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-882s1c1
Sequence:CCGGCCCAGACAAATCCACCATCATCTCGAGATGATGGTGGATTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-818s21c1
Sequence:CCGGTGGGATCATCTAAGGGTAATGCTCGAGCATTACCCTTAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-1133s21c1
Sequence:CCGGGAGATGTAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175647
DMRTA1 MISSION shRNA shRNA Plasmid DNA
DMRT-like family A1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1471s1c1
Sequence:CCGGCCAACTTTGGATTATGCGTTTCTCGAGAAACGCATAATCCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175647.2-2071s1c1
Sequence:CCGGCCAGAAATTGTTCCAAGTATTCTCGAGAATACTTGGAACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1259s1c1
Sequence:CCGGGCATTGGCTTTGGGACTCTAACTCGAGTTAGAGTCCCAAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-717s1c1
Sequence:CCGGGCAAGATTATGCTGACAGAAACTCGAGTTTCTGTCAGCATAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-882s1c1
Sequence:CCGGCCCAGACAAATCCACCATCATCTCGAGATGATGGTGGATTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-818s21c1
Sequence:CCGGTGGGATCATCTAAGGGTAATGCTCGAGCATTACCCTTAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-1133s21c1
Sequence:CCGGGAGATGTAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175647
DMRTA1 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family A1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1471s1c1
Sequence:CCGGCCAACTTTGGATTATGCGTTTCTCGAGAAACGCATAATCCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175647.2-2071s1c1
Sequence:CCGGCCAGAAATTGTTCCAAGTATTCTCGAGAATACTTGGAACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-1259s1c1
Sequence:CCGGGCATTGGCTTTGGGACTCTAACTCGAGTTAGAGTCCCAAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-717s1c1
Sequence:CCGGGCAAGATTATGCTGACAGAAACTCGAGTTTCTGTCAGCATAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175647.2-882s1c1
Sequence:CCGGCCCAGACAAATCCACCATCATCTCGAGATGATGGTGGATTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-818s21c1
Sequence:CCGGTGGGATCATCTAAGGGTAATGCTCGAGCATTACCCTTAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175647.3-1133s21c1
Sequence:CCGGGAGATGTAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022160
DMRTA1 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family A1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1627s1c1
Sequence:CCGGCCAGCTTTGGATTATGCCTTTCTCGAGAAAGGCATAATCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1354s1c1
Sequence:CCGGGCAAACTCAGAAGAACTGGAACTCGAGTTCCAGTTCTTCTGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1842s1c1
Sequence:CCGGGAGTGGATTATGAGGTCTTAACTCGAGTTAAGACCTCATAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-2136s1c1
Sequence:CCGGCGAAAGGAAGAACTGAACAATCTCGAGATTGTTCAGTTCTTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1750s1c1
Sequence:CCGGCCATTCTCTCTTTCTGGAGTTCTCGAGAACTCCAGAAAGAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1506s1c1
Sequence:CCGGCGTAAATCCTAGAGTAGGTATCTCGAGATACCTACTCTAGGATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-937s1c1
Sequence:CCGGGAACTGATCTCCAAATCCCATCTCGAGATGGGATTTGGAGATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022160.1-2135s1c1
Sequence:CCGGCCGAAAGGAAGAACTGAACAACTCGAGTTGTTCAGTTCTTCCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1527s1c1
Sequence:CCGGCAGTCCATTAAGGCTGGCATACTCGAGTATGCCAGCCTTAATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1045s1c1
Sequence:CCGGCCTGATAGTATCCTGTCTCCTCTCGAGAGGAGACAGGATACTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1703s1c1
Sequence:CCGGGCAGACTGTACTTCAGACCAACTCGAGTTGGTCTGAAGTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022160
DMRTA1 MISSION shRNA shRNA Plasmid DNA
DMRT-like family A1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1627s1c1
Sequence:CCGGCCAGCTTTGGATTATGCCTTTCTCGAGAAAGGCATAATCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1354s1c1
Sequence:CCGGGCAAACTCAGAAGAACTGGAACTCGAGTTCCAGTTCTTCTGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1842s1c1
Sequence:CCGGGAGTGGATTATGAGGTCTTAACTCGAGTTAAGACCTCATAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-2136s1c1
Sequence:CCGGCGAAAGGAAGAACTGAACAATCTCGAGATTGTTCAGTTCTTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1750s1c1
Sequence:CCGGCCATTCTCTCTTTCTGGAGTTCTCGAGAACTCCAGAAAGAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1506s1c1
Sequence:CCGGCGTAAATCCTAGAGTAGGTATCTCGAGATACCTACTCTAGGATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-937s1c1
Sequence:CCGGGAACTGATCTCCAAATCCCATCTCGAGATGGGATTTGGAGATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022160.1-2135s1c1
Sequence:CCGGCCGAAAGGAAGAACTGAACAACTCGAGTTGTTCAGTTCTTCCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1527s1c1
Sequence:CCGGCAGTCCATTAAGGCTGGCATACTCGAGTATGCCAGCCTTAATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1045s1c1
Sequence:CCGGCCTGATAGTATCCTGTCTCCTCTCGAGAGGAGACAGGATACTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1703s1c1
Sequence:CCGGGCAGACTGTACTTCAGACCAACTCGAGTTGGTCTGAAGTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022160
DMRTA1 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family A1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1627s1c1
Sequence:CCGGCCAGCTTTGGATTATGCCTTTCTCGAGAAAGGCATAATCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1354s1c1
Sequence:CCGGGCAAACTCAGAAGAACTGGAACTCGAGTTCCAGTTCTTCTGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1842s1c1
Sequence:CCGGGAGTGGATTATGAGGTCTTAACTCGAGTTAAGACCTCATAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-2136s1c1
Sequence:CCGGCGAAAGGAAGAACTGAACAATCTCGAGATTGTTCAGTTCTTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022160.1-1750s1c1
Sequence:CCGGCCATTCTCTCTTTCTGGAGTTCTCGAGAACTCCAGAAAGAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022160.1-1506s1c1
Sequence:CCGGCGTAAATCCTAGAGTAGGTATCTCGAGATACCTACTCTAGGATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-937s1c1
Sequence:CCGGGAACTGATCTCCAAATCCCATCTCGAGATGGGATTTGGAGATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022160.1-2135s1c1
Sequence:CCGGCCGAAAGGAAGAACTGAACAACTCGAGTTGTTCAGTTCTTCCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1527s1c1
Sequence:CCGGCAGTCCATTAAGGCTGGCATACTCGAGTATGCCAGCCTTAATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1045s1c1
Sequence:CCGGCCTGATAGTATCCTGTCTCCTCTCGAGAGGAGACAGGATACTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022160.1-1703s1c1
Sequence:CCGGGCAGACTGTACTTCAGACCAACTCGAGTTGGTCTGAAGTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks