EMAIL THIS PAGE TO A FRIEND

DMRTA2

DMRT-like family A2

54 Gene Product Result for
UniProtKB ID: Q96SC8, Q5TFQ3
Gene ID:
Mouse(242620) doublesex and mab-3 related transcription factor like family A2
Rat(313471) DMRT-like family A2
sheep(101108701) DMRT-like family A2
domestic guinea pig(100726803) DMRT-like family A2
naked mole-rat(101724072) DMRT-like family A2
Zebrafish(474350) doublesex and mab-3 related transcription factor like family A2
cow(537680) DMRT-like family A2
domestic cat(101090787) DMRT-like family A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_027162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_027162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_027162 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060921 MISSION® esiRNA esiRNA targeting mouse Dmrta2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032110 Rosetta Predictions human pricing
XM_027162 Rosetta Predictions human pricing
NM_001107951 Rosetta Predictions rat pricing
NM_172296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359299 predicted 1941
2 SASI_Hs02_00359300 predicted 814
3 SASI_Hs02_00359301 predicted 1218
4 SASI_Hs02_00359302 predicted 1068
5 SASI_Hs02_00359303 predicted 922
6 SASI_Hs02_00359304 predicted 1866
7 SASI_Hs02_00359305 predicted 1816
8 SASI_Hs02_00359306 predicted 1855
9 SASI_Hs02_00359307 predicted 2288
10 SASI_Hs02_00359308 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_027162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299139 predicted 453
2 SASI_Hs01_00299140 predicted 720
3 SASI_Hs01_00299141 predicted 706
4 SASI_Hs01_00299142 predicted 561
5 SASI_Hs01_00299143 predicted 941
6 SASI_Hs01_00299144 predicted 831
7 SASI_Hs01_00299145 predicted 869
8 SASI_Hs01_00299146 predicted 569
9 SASI_Hs01_00299147 predicted 461
10 SASI_Hs01_00299148 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233895 predicted 1315
2 SASI_Rn02_00233896 predicted 2077
3 SASI_Rn02_00233897 predicted 1851
4 SASI_Rn02_00233898 predicted 843
5 SASI_Rn02_00233899 predicted 2077
6 SASI_Rn02_00233900 predicted 747
7 SASI_Rn02_00233901 predicted 456
8 SASI_Rn02_00233902 predicted 857
9 SASI_Rn02_00233903 predicted 1314
10 SASI_Rn02_00233904 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076591 predicted 2134
2 SASI_Mm01_00076592 predicted 1864
3 SASI_Mm01_00076593 predicted 1869
4 SASI_Mm01_00076594 predicted 1274
5 SASI_Mm01_00076595 predicted 772
6 SASI_Mm01_00076596 predicted 864
7 SASI_Mm01_00076597 predicted 2002
8 SASI_Mm01_00076598 predicted 695
9 SASI_Mm01_00076599 predicted 1169
10 SASI_Mm01_00076600 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172296
DMRTA2 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family A2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-695s21c1
Sequence:CCGGGCGCGAGTTGCAATTGCTGTACTCGAGTACAGCAATTGCAACTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-1174s21c1
Sequence:CCGGGTTCGGAGGCTGACAAAGAAGCTCGAGCTTCTTTGTCAGCCTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172296.1-2426s1c1
Sequence:CCGGGCGGTATTTGTCGCTCTCTTTCTCGAGAAAGAGAGCGACAAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-574s1c1
Sequence:CCGGGTGCGCCAAGTGTACGCTCATCTCGAGATGAGCGTACACTTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-839s1c1
Sequence:CCGGGAGGCCAAATTGCAGAAGTTTCTCGAGAAACTTCTGCAATTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-740s1c1
Sequence:CCGGCGGCCTGCCTACGAAGTCTTTCTCGAGAAAGACTTCGTAGGCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-842s1c1
Sequence:CCGGGCCAAATTGCAGAAGTTTGATCTCGAGATCAAACTTCTGCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172296
DMRTA2 MISSION shRNA shRNA Plasmid DNA
DMRT-like family A2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-695s21c1
Sequence:CCGGGCGCGAGTTGCAATTGCTGTACTCGAGTACAGCAATTGCAACTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-1174s21c1
Sequence:CCGGGTTCGGAGGCTGACAAAGAAGCTCGAGCTTCTTTGTCAGCCTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172296.1-2426s1c1
Sequence:CCGGGCGGTATTTGTCGCTCTCTTTCTCGAGAAAGAGAGCGACAAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-574s1c1
Sequence:CCGGGTGCGCCAAGTGTACGCTCATCTCGAGATGAGCGTACACTTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-839s1c1
Sequence:CCGGGAGGCCAAATTGCAGAAGTTTCTCGAGAAACTTCTGCAATTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-740s1c1
Sequence:CCGGCGGCCTGCCTACGAAGTCTTTCTCGAGAAAGACTTCGTAGGCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-842s1c1
Sequence:CCGGGCCAAATTGCAGAAGTTTGATCTCGAGATCAAACTTCTGCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172296
DMRTA2 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family A2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-695s21c1
Sequence:CCGGGCGCGAGTTGCAATTGCTGTACTCGAGTACAGCAATTGCAACTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172296.2-1174s21c1
Sequence:CCGGGTTCGGAGGCTGACAAAGAAGCTCGAGCTTCTTTGTCAGCCTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172296.1-2426s1c1
Sequence:CCGGGCGGTATTTGTCGCTCTCTTTCTCGAGAAAGAGAGCGACAAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-574s1c1
Sequence:CCGGGTGCGCCAAGTGTACGCTCATCTCGAGATGAGCGTACACTTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-839s1c1
Sequence:CCGGGAGGCCAAATTGCAGAAGTTTCTCGAGAAACTTCTGCAATTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-740s1c1
Sequence:CCGGCGGCCTGCCTACGAAGTCTTTCTCGAGAAAGACTTCGTAGGCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172296.1-842s1c1
Sequence:CCGGGCCAAATTGCAGAAGTTTGATCTCGAGATCAAACTTCTGCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_027162
DMRTA2 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1332s1c1
Sequence:CCGGCTACGCCTTTAGCGATCTCATCTCGAGATGAGATCGCTAAAGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1620s1c1
Sequence:CCGGGTACGCAACCATGAAGCAAATCTCGAGATTTGCTTCATGGTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1537s1c1
Sequence:CCGGGCCAAACTACCCACTGTTGATCTCGAGATCAACAGTGGGTAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-490s1c1
Sequence:CCGGGAGGCCAAGTTGCAGAAGTTTCTCGAGAAACTTCTGCAACTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1456s1c1
Sequence:CCGGCGTGACAAATGGTTGTGCCAACTCGAGTTGGCACAACCATTTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_027162
DMRTA2 MISSION shRNA shRNA Plasmid DNA
DMRT-like family A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1332s1c1
Sequence:CCGGCTACGCCTTTAGCGATCTCATCTCGAGATGAGATCGCTAAAGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1620s1c1
Sequence:CCGGGTACGCAACCATGAAGCAAATCTCGAGATTTGCTTCATGGTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1537s1c1
Sequence:CCGGGCCAAACTACCCACTGTTGATCTCGAGATCAACAGTGGGTAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-490s1c1
Sequence:CCGGGAGGCCAAGTTGCAGAAGTTTCTCGAGAAACTTCTGCAACTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1456s1c1
Sequence:CCGGCGTGACAAATGGTTGTGCCAACTCGAGTTGGCACAACCATTTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_027162
DMRTA2 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1332s1c1
Sequence:CCGGCTACGCCTTTAGCGATCTCATCTCGAGATGAGATCGCTAAAGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1620s1c1
Sequence:CCGGGTACGCAACCATGAAGCAAATCTCGAGATTTGCTTCATGGTTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1537s1c1
Sequence:CCGGGCCAAACTACCCACTGTTGATCTCGAGATCAACAGTGGGTAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-490s1c1
Sequence:CCGGGAGGCCAAGTTGCAGAAGTTTCTCGAGAAACTTCTGCAACTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027162.3-1456s1c1
Sequence:CCGGCGTGACAAATGGTTGTGCCAACTCGAGTTGGCACAACCATTTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks