EMAIL THIS PAGE TO A FRIEND

DMRTB1

DMRT-like family B with proline-rich C-terminal, 1

144 Gene Product Result for
UniProtKB ID: Q96MA1, Q96SD2
Gene ID:
Mouse(56296) DMRT-like family B with proline-rich C-terminal, 1
Rat(313484) DMRT-like family B with proline-rich C-terminal, 1
chicken(429107) DMRT-like family B with proline-rich C-terminal, 1
dog(610652) DMRT-like family B with proline-rich C-terminal, 1
domestic cat(101093536) DMRT-like family B with proline-rich C-terminal, 1
cow(516987) DMRT-like family B with proline-rich C-terminal, 1
domestic guinea pig(100712620) DMRT-like family B with proline-rich C-terminal, 1
sheep(101116952) DMRT-like family B with proline-rich C-terminal, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_205469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033067 Rosetta Predictions human pricing
XM_001066505 Rosetta Predictions rat pricing
XM_233356 Rosetta Predictions rat pricing
XM_205469 Rosetta Predictions mouse pricing
XM_916034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231719 predicted 1440
2 SASI_Hs01_00231720 predicted 624
3 SASI_Hs01_00231721 predicted 1195
4 SASI_Hs01_00231722 predicted 1337
5 SASI_Hs01_00231723 predicted 1332
6 SASI_Hs01_00231724 predicted 1229
7 SASI_Hs01_00231725 predicted 1334
8 SASI_Hs01_00231726 predicted 1171
9 SASI_Hs01_00231727 predicted 1500
10 SASI_Hs02_00360767 predicted 1501
11 SASI_Hs01_00231728 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317717 predicted 650
2 SASI_Rn02_00317718 predicted 329
3 SASI_Rn02_00317719 predicted 217
4 SASI_Rn02_00317720 predicted 333
5 SASI_Rn02_00317721 predicted 641
6 SASI_Rn02_00317722 predicted 441
7 SASI_Rn02_00317723 predicted 666
8 SASI_Rn02_00317724 predicted 392
9 SASI_Rn02_00317725 predicted 655
10 SASI_Rn02_00317726 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387692 predicted 651
2 SASI_Rn02_00387693 predicted 332
3 SASI_Rn02_00387694 predicted 226
4 SASI_Rn02_00387695 predicted 335
5 SASI_Rn02_00387696 predicted 640
6 SASI_Rn02_00387697 predicted 441
7 SASI_Rn02_00387698 predicted 669
8 SASI_Rn02_00387699 predicted 400
9 SASI_Rn02_00387700 predicted 653
10 SASI_Rn02_00387701 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_205469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267587 predicted 1360
2 SASI_Mm01_00267588 predicted 1189
3 SASI_Mm02_00425579 predicted 1250
4 SASI_Mm01_00267590 predicted 572
5 SASI_Mm02_00425580 predicted 577
6 SASI_Mm01_00267591 predicted 235
7 SASI_Mm01_00267592 predicted 602
8 SASI_Mm02_00425581 predicted 1417
9 SASI_Mm01_00267594 predicted 1419
10 SASI_Mm01_00267595 predicted 584
11 SASI_Mm01_00267589 predicted 247
12 SASI_Mm01_00267593 predicted 321
13 SASI_Mm01_00267596 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440000 predicted 1358
2 SASI_Mm02_00440001 predicted 1192
3 SASI_Mm02_00440002 predicted 1255
4 SASI_Mm02_00440003 predicted 574
5 SASI_Mm02_00440004 predicted 577
6 SASI_Mm02_00440005 predicted 234
7 SASI_Mm02_00440006 predicted 598
8 SASI_Mm02_00440007 predicted 1415
9 SASI_Mm02_00440008 predicted 1419
10 SASI_Mm02_00440009 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033067
DMRTB1 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family B with proline-rich C-terminal, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-613s1c1
Sequence:CCGGCCCACTGTTCACCGACTTTGTCTCGAGACAAAGTCGGTGAACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-637s1c1
Sequence:CCGGCCCTCTGAACATCAACCCGGACTCGAGTCCGGGTTGATGTTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-985s1c1
Sequence:CCGGCGTCCTGTTTGATACTGACAACTCGAGTTGTCAGTATCAAACAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-160s1c1
Sequence:CCGGCCTCTGCGAGAAGTGCTACCTCTCGAGAGGTAGCACTTCTCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-1007s1c1
Sequence:CCGGGAGAACACTGATGACCAGGATCTCGAGATCCTGGTCATCAGTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-91s21c1
Sequence:CCGGGAGATGCAGGAACCATGGCTTCTCGAGAAGCCATGGTTCCTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033067.1-1275s21c1
Sequence:CCGGGAGTGTGGAGGAAGCTATTACCTCGAGGTAATAGCTTCCTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-823s21c1
Sequence:CCGGAGACTTCCAGCCAAGCTACTACTCGAGTAGTAGCTTGGCTGGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033067
DMRTB1 MISSION shRNA shRNA Plasmid DNA
DMRT-like family B with proline-rich C-terminal, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-613s1c1
Sequence:CCGGCCCACTGTTCACCGACTTTGTCTCGAGACAAAGTCGGTGAACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-637s1c1
Sequence:CCGGCCCTCTGAACATCAACCCGGACTCGAGTCCGGGTTGATGTTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-985s1c1
Sequence:CCGGCGTCCTGTTTGATACTGACAACTCGAGTTGTCAGTATCAAACAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-160s1c1
Sequence:CCGGCCTCTGCGAGAAGTGCTACCTCTCGAGAGGTAGCACTTCTCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-1007s1c1
Sequence:CCGGGAGAACACTGATGACCAGGATCTCGAGATCCTGGTCATCAGTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-91s21c1
Sequence:CCGGGAGATGCAGGAACCATGGCTTCTCGAGAAGCCATGGTTCCTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033067.1-1275s21c1
Sequence:CCGGGAGTGTGGAGGAAGCTATTACCTCGAGGTAATAGCTTCCTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-823s21c1
Sequence:CCGGAGACTTCCAGCCAAGCTACTACTCGAGTAGTAGCTTGGCTGGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033067
DMRTB1 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family B with proline-rich C-terminal, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-613s1c1
Sequence:CCGGCCCACTGTTCACCGACTTTGTCTCGAGACAAAGTCGGTGAACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-637s1c1
Sequence:CCGGCCCTCTGAACATCAACCCGGACTCGAGTCCGGGTTGATGTTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-985s1c1
Sequence:CCGGCGTCCTGTTTGATACTGACAACTCGAGTTGTCAGTATCAAACAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-160s1c1
Sequence:CCGGCCTCTGCGAGAAGTGCTACCTCTCGAGAGGTAGCACTTCTCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033067.1-1007s1c1
Sequence:CCGGGAGAACACTGATGACCAGGATCTCGAGATCCTGGTCATCAGTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-91s21c1
Sequence:CCGGGAGATGCAGGAACCATGGCTTCTCGAGAAGCCATGGTTCCTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033067.1-1275s21c1
Sequence:CCGGGAGTGTGGAGGAAGCTATTACCTCGAGGTAATAGCTTCCTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033067.1-823s21c1
Sequence:CCGGAGACTTCCAGCCAAGCTACTACTCGAGTAGTAGCTTGGCTGGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205469
DMRTB1 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family B with proline-rich C-terminal, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-681s21c1
Sequence:CCGGCTACCAGTCCTTTCCACTTTCCTCGAGGAAAGTGGAAAGGACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-580s21c1
Sequence:CCGGTACGGGCATCCTCTGAGATTCCTCGAGGAATCTCAGAGGATGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_205469.7-1141s21c1
Sequence:CCGGTTCACCATGTTCATGTTATATCTCGAGATATAACATGAACATGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-961s21c1
Sequence:CCGGCCACCATCTCCACCATCTTTCCTCGAGGAAAGATGGTGGAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-56s21c1
Sequence:CCGGTCAAGGGCCATACGGGCAAATCTCGAGATTTGCCCGTATGGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205469
DMRTB1 MISSION shRNA shRNA Plasmid DNA
DMRT-like family B with proline-rich C-terminal, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-681s21c1
Sequence:CCGGCTACCAGTCCTTTCCACTTTCCTCGAGGAAAGTGGAAAGGACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-580s21c1
Sequence:CCGGTACGGGCATCCTCTGAGATTCCTCGAGGAATCTCAGAGGATGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_205469.7-1141s21c1
Sequence:CCGGTTCACCATGTTCATGTTATATCTCGAGATATAACATGAACATGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-961s21c1
Sequence:CCGGCCACCATCTCCACCATCTTTCCTCGAGGAAAGATGGTGGAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-56s21c1
Sequence:CCGGTCAAGGGCCATACGGGCAAATCTCGAGATTTGCCCGTATGGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205469
DMRTB1 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family B with proline-rich C-terminal, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-681s21c1
Sequence:CCGGCTACCAGTCCTTTCCACTTTCCTCGAGGAAAGTGGAAAGGACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-580s21c1
Sequence:CCGGTACGGGCATCCTCTGAGATTCCTCGAGGAATCTCAGAGGATGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_205469.7-1141s21c1
Sequence:CCGGTTCACCATGTTCATGTTATATCTCGAGATATAACATGAACATGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-961s21c1
Sequence:CCGGCCACCATCTCCACCATCTTTCCTCGAGGAAAGATGGTGGAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_205469.7-56s21c1
Sequence:CCGGTCAAGGGCCATACGGGCAAATCTCGAGATTTGCCCGTATGGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks