EMAIL THIS PAGE TO A FRIEND

DMRTC1

DMRT-like family C1

17 Gene Product Result for
Species: Human DMRTC1(63947)
UniProtKB ID: Q5HYR2, Q5HYR0, Q5U5K2, Q8N6L3, Q96SD3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033053 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116691 MISSION® esiRNA esiRNA human DMRTC1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033053 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084629 predicted 682
2 SASI_Hs01_00084630 predicted 649
3 SASI_Hs01_00084631 predicted 702
4 SASI_Hs01_00084633 predicted 443
5 SASI_Hs01_00084634 predicted 651
6 SASI_Hs01_00084635 predicted 810
7 SASI_Hs02_00360745 predicted 285
8 SASI_Hs01_00084636 predicted 833
9 SASI_Hs01_00084637 predicted 620
10 SASI_Hs01_00084638 predicted 509
11 SASI_Hs01_00084632 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033053
DMRTC1 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family C1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-640s21c1
Sequence:CCGGTGGACATCTGGGATGCATCTCCTCGAGGAGATGCATCCCAGATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-841s21c1
Sequence:CCGGTTGTACCTCTGTCCCTTACTCCTCGAGGAGTAAGGGACAGAGGTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-290s21c1
Sequence:CCGGTTGGAGCAGCAACTGGTTTCTCTCGAGAGAAACCAGTTGCTGCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-819s21c1
Sequence:CCGGCCTTGGCTGAGGGTGGATATTCTCGAGAATATCCACCCTCAGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-639s1c1
Sequence:CCGGCCTCAATAGAGCACTGCCTATCTCGAGATAGGCAGTGCTCTATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-849s1c1
Sequence:CCGGGATTGTGCAATCTAAGTTGATCTCGAGATCAACTTAGATTGCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-832s1c1
Sequence:CCGGCTGTCTCATAAAGACAGGATTCTCGAGAATCCTGTCTTTATGAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-892s1c1
Sequence:CCGGGTGAGTTCATATGCCAGAGTTCTCGAGAACTCTGGCATATGAACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-306s1c1
Sequence:CCGGGAAGGAGAACAACATGCTGCACTCGAGTGCAGCATGTTGTTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-649s1c1
Sequence:CCGGGCACTGCCTATTTGGTATCCACTCGAGTGGATACCAAATAGGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-366s1c1
Sequence:CCGGCAAAGTCTCTGACCAGGCTTTCTCGAGAAAGCCTGGTCAGAGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-300s1c1
Sequence:CCGGCACTGGGAAGGAGAACAACATCTCGAGATGTTGTTCTCCTTCCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033053
DMRTC1 MISSION shRNA shRNA Plasmid DNA
DMRT-like family C1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-640s21c1
Sequence:CCGGTGGACATCTGGGATGCATCTCCTCGAGGAGATGCATCCCAGATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-841s21c1
Sequence:CCGGTTGTACCTCTGTCCCTTACTCCTCGAGGAGTAAGGGACAGAGGTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-290s21c1
Sequence:CCGGTTGGAGCAGCAACTGGTTTCTCTCGAGAGAAACCAGTTGCTGCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-819s21c1
Sequence:CCGGCCTTGGCTGAGGGTGGATATTCTCGAGAATATCCACCCTCAGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-639s1c1
Sequence:CCGGCCTCAATAGAGCACTGCCTATCTCGAGATAGGCAGTGCTCTATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-849s1c1
Sequence:CCGGGATTGTGCAATCTAAGTTGATCTCGAGATCAACTTAGATTGCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-832s1c1
Sequence:CCGGCTGTCTCATAAAGACAGGATTCTCGAGAATCCTGTCTTTATGAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-892s1c1
Sequence:CCGGGTGAGTTCATATGCCAGAGTTCTCGAGAACTCTGGCATATGAACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-306s1c1
Sequence:CCGGGAAGGAGAACAACATGCTGCACTCGAGTGCAGCATGTTGTTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-649s1c1
Sequence:CCGGGCACTGCCTATTTGGTATCCACTCGAGTGGATACCAAATAGGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-366s1c1
Sequence:CCGGCAAAGTCTCTGACCAGGCTTTCTCGAGAAAGCCTGGTCAGAGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-300s1c1
Sequence:CCGGCACTGGGAAGGAGAACAACATCTCGAGATGTTGTTCTCCTTCCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033053
DMRTC1 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family C1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-640s21c1
Sequence:CCGGTGGACATCTGGGATGCATCTCCTCGAGGAGATGCATCCCAGATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-841s21c1
Sequence:CCGGTTGTACCTCTGTCCCTTACTCCTCGAGGAGTAAGGGACAGAGGTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033053.2-290s21c1
Sequence:CCGGTTGGAGCAGCAACTGGTTTCTCTCGAGAGAAACCAGTTGCTGCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033053.2-819s21c1
Sequence:CCGGCCTTGGCTGAGGGTGGATATTCTCGAGAATATCCACCCTCAGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-639s1c1
Sequence:CCGGCCTCAATAGAGCACTGCCTATCTCGAGATAGGCAGTGCTCTATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-849s1c1
Sequence:CCGGGATTGTGCAATCTAAGTTGATCTCGAGATCAACTTAGATTGCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-832s1c1
Sequence:CCGGCTGTCTCATAAAGACAGGATTCTCGAGAATCCTGTCTTTATGAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-892s1c1
Sequence:CCGGGTGAGTTCATATGCCAGAGTTCTCGAGAACTCTGGCATATGAACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-306s1c1
Sequence:CCGGGAAGGAGAACAACATGCTGCACTCGAGTGCAGCATGTTGTTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033053.1-649s1c1
Sequence:CCGGGCACTGCCTATTTGGTATCCACTCGAGTGGATACCAAATAGGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-366s1c1
Sequence:CCGGCAAAGTCTCTGACCAGGCTTTCTCGAGAAAGCCTGGTCAGAGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033053.1-300s1c1
Sequence:CCGGCACTGGGAAGGAGAACAACATCTCGAGATGTTGTTCTCCTTCCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)