EMAIL THIS PAGE TO A FRIEND

DMRTC1B

DMRT-like family C1B

121 Gene Product Result for
Gene ID:
Mouse(632708) DMRT-like family C1b
Rat(680068) DMRT-like family C1b
dog(491957) doublesex- and mab-3-related transcription factor C1-like
domestic cat(101081365) DMRT-like family C1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305689 ANTI-DMRTC1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080851 Rosetta Predictions human pricing
XM_001055549 Rosetta Predictions rat pricing
NM_001039116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316147 predicted 686
2 SASI_Hs02_00316148 predicted 641
3 SASI_Hs02_00316149 predicted 701
4 SASI_Hs02_00316150 predicted 444
5 SASI_Hs02_00316151 predicted 653
6 SASI_Hs02_00316152 predicted 812
7 SASI_Hs02_00316153 predicted 286
8 SASI_Hs02_00316154 predicted 834
9 SASI_Hs02_00316155 predicted 624
10 SASI_Hs02_00316156 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279974 predicted 815
2 SASI_Rn02_00279975 predicted 1072
3 SASI_Rn02_00279976 predicted 907
4 SASI_Rn02_00279977 predicted 757
5 SASI_Rn02_00279978 predicted 945
6 SASI_Rn02_00279979 predicted 1344
7 SASI_Rn02_00279980 predicted 1222
8 SASI_Rn02_00279981 predicted 728
9 SASI_Rn02_00279982 predicted 1121
10 SASI_Rn02_00279983 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173116 predicted 265
2 SASI_Mm01_00173117 predicted 312
3 SASI_Mm01_00173118 predicted 320
4 SASI_Mm01_00173119 predicted 441
5 SASI_Mm01_00173120 predicted 700
6 SASI_Mm01_00173121 predicted 236
7 SASI_Mm01_00173122 predicted 451
8 SASI_Mm01_00173124 predicted 405
9 SASI_Mm01_00173125 predicted 649
10 SASI_Mm02_00289807 predicted 696
11 SASI_Mm01_00173123 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039116
DMRTC1B MISSION shRNA Bacterial Glycerol Stock
DMRT-like family C1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039116.1-759s21c1
Sequence:CCGGGCCTGTTTGGTATCCTGTTTCCTCGAGGAAACAGGATACCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-94s21c1
Sequence:CCGGCTGGATCAAGGAGTGATAAAGCTCGAGCTTTATCACTCCTTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-404s21c1
Sequence:CCGGATGCAGTCACTGATCCTCTTCCTCGAGGAAGAGGATCAGTGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-117s21c1
Sequence:CCGGTATGGCCTGTACTCCTAAATTCTCGAGAATTTAGGAGTACAGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-708s21c1
Sequence:CCGGCATGTCCTTCTTCACCTAAGACTCGAGTCTTAGGTGAAGAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039116
DMRTC1B MISSION shRNA shRNA Plasmid DNA
DMRT-like family C1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039116.1-759s21c1
Sequence:CCGGGCCTGTTTGGTATCCTGTTTCCTCGAGGAAACAGGATACCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-94s21c1
Sequence:CCGGCTGGATCAAGGAGTGATAAAGCTCGAGCTTTATCACTCCTTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-404s21c1
Sequence:CCGGATGCAGTCACTGATCCTCTTCCTCGAGGAAGAGGATCAGTGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-117s21c1
Sequence:CCGGTATGGCCTGTACTCCTAAATTCTCGAGAATTTAGGAGTACAGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-708s21c1
Sequence:CCGGCATGTCCTTCTTCACCTAAGACTCGAGTCTTAGGTGAAGAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039116
DMRTC1B MISSION shRNA Lentiviral Transduction Particles
DMRT-like family C1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039116.1-759s21c1
Sequence:CCGGGCCTGTTTGGTATCCTGTTTCCTCGAGGAAACAGGATACCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-94s21c1
Sequence:CCGGCTGGATCAAGGAGTGATAAAGCTCGAGCTTTATCACTCCTTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-404s21c1
Sequence:CCGGATGCAGTCACTGATCCTCTTCCTCGAGGAAGAGGATCAGTGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-117s21c1
Sequence:CCGGTATGGCCTGTACTCCTAAATTCTCGAGAATTTAGGAGTACAGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039116.1-708s21c1
Sequence:CCGGCATGTCCTTCTTCACCTAAGACTCGAGTCTTAGGTGAAGAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080851
DMRTC1B MISSION shRNA Bacterial Glycerol Stock
DMRT-like family C1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080851.1-820s21c1
Sequence:CCGGCTTGGCTGAGGGTGGATATTCCTCGAGGAATATCCACCCTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-123s21c1
Sequence:CCGGGTGTCAGGAATTTGACCATCACTCGAGTGATGGTCAAATTCCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-620s21c1
Sequence:CCGGAGCTCCATCTCGCTGCCTATTCTCGAGAATAGGCAGCGAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-558s21c1
Sequence:CCGGCAGCTCCTGCTGGAGATAAAGCTCGAGCTTTATCTCCAGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-289s21c1
Sequence:CCGGCTTGGAGCAGCAACTGGTTTCCTCGAGGAAACCAGTTGCTGCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080851
DMRTC1B MISSION shRNA shRNA Plasmid DNA
DMRT-like family C1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080851.1-820s21c1
Sequence:CCGGCTTGGCTGAGGGTGGATATTCCTCGAGGAATATCCACCCTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-123s21c1
Sequence:CCGGGTGTCAGGAATTTGACCATCACTCGAGTGATGGTCAAATTCCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-620s21c1
Sequence:CCGGAGCTCCATCTCGCTGCCTATTCTCGAGAATAGGCAGCGAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-558s21c1
Sequence:CCGGCAGCTCCTGCTGGAGATAAAGCTCGAGCTTTATCTCCAGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-289s21c1
Sequence:CCGGCTTGGAGCAGCAACTGGTTTCCTCGAGGAAACCAGTTGCTGCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080851
DMRTC1B MISSION shRNA Lentiviral Transduction Particles
DMRT-like family C1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080851.1-820s21c1
Sequence:CCGGCTTGGCTGAGGGTGGATATTCCTCGAGGAATATCCACCCTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-123s21c1
Sequence:CCGGGTGTCAGGAATTTGACCATCACTCGAGTGATGGTCAAATTCCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-620s21c1
Sequence:CCGGAGCTCCATCTCGCTGCCTATTCTCGAGAATAGGCAGCGAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-558s21c1
Sequence:CCGGCAGCTCCTGCTGGAGATAAAGCTCGAGCTTTATCTCCAGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080851.1-289s21c1
Sequence:CCGGCTTGGAGCAGCAACTGGTTTCCTCGAGGAAACCAGTTGCTGCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks