EMAIL THIS PAGE TO A FRIEND

DMRTC2

DMRT-like family C2

75 Gene Product Result for
UniProtKB ID: Q8IXT2, Q8N6Q2, Q96M39, Q96SD4
Gene ID:
Mouse(71241) doublesex and mab-3 related transcription factor like family C2
Rat(499100) DMRT-like family C2
sheep(101106355) DMRT-like family C2
domestic guinea pig(100725551) DMRT-like family C2
naked mole-rat(101726651) DMRT-like family C2
domestic cat(101082611) DMRT-like family C2
cow(539134) DMRT-like family C2
dog(612468) DMRT-like family C2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033052 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092511 MISSION® esiRNA esiRNA human DMRTC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040283 Rosetta Predictions human pricing
NM_001109140 Rosetta Predictions rat pricing
NM_027732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187406 predicted 399
2 SASI_Hs01_00187407 predicted 786
3 SASI_Hs01_00187408 predicted 762
4 SASI_Hs01_00187409 predicted 362
5 SASI_Hs01_00187410 predicted 264
6 SASI_Hs01_00187411 predicted 396
7 SASI_Hs01_00187412 predicted 393
8 SASI_Hs01_00187413 predicted 225
9 SASI_Hs01_00187414 predicted 397
10 SASI_Hs01_00187415 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245520 predicted 1306
2 SASI_Rn02_00245521 predicted 1263
3 SASI_Rn02_00245522 predicted 910
4 SASI_Rn02_00245523 predicted 877
5 SASI_Rn02_00245524 predicted 864
6 SASI_Rn02_00245525 predicted 806
7 SASI_Rn02_00245526 predicted 1272
8 SASI_Rn02_00245527 predicted 1328
9 SASI_Rn02_00245528 predicted 1252
10 SASI_Rn02_00245529 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151312 predicted 878
2 SASI_Mm01_00151313 predicted 806
3 SASI_Mm01_00151314 predicted 291
4 SASI_Mm01_00151315 predicted 879
5 SASI_Mm01_00151316 predicted 216
6 SASI_Mm01_00151317 predicted 817
7 SASI_Mm01_00151318 predicted 699
8 SASI_Mm02_00332666 predicted 476
9 SASI_Mm01_00151320 predicted 220
10 SASI_Mm01_00151321 predicted 746
11 SASI_Mm01_00151319 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027732
DMRTC2 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family C2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027732.1-825s21c1
Sequence:CCGGAGTACTGACGGCTCCACTTTCCTCGAGGAAAGTGGAGCCGTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027732.1-1275s21c1
Sequence:CCGGACTGCAGGCACTGCATATTTGCTCGAGCAAATATGCAGTGCCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-318s1c1
Sequence:CCGGGTGTCACAAATGTGTCCTCATCTCGAGATGAGGACACATTTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-873s1c1
Sequence:CCGGGCCTCACACATGTTCAACTCTCTCGAGAGAGTTGAACATGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-887s1c1
Sequence:CCGGCAACTCTGATACTCCAGTCCTCTCGAGAGGACTGGAGTATCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027732.1-1460s1c1
Sequence:CCGGGCAGTTTAAGATGACCCATATCTCGAGATATGGGTCATCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-483s1c1
Sequence:CCGGGCCAGGGATCCCTTCTGGAAACTCGAGTTTCCAGAAGGGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027732
DMRTC2 MISSION shRNA shRNA Plasmid DNA
DMRT-like family C2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027732.1-825s21c1
Sequence:CCGGAGTACTGACGGCTCCACTTTCCTCGAGGAAAGTGGAGCCGTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027732.1-1275s21c1
Sequence:CCGGACTGCAGGCACTGCATATTTGCTCGAGCAAATATGCAGTGCCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-318s1c1
Sequence:CCGGGTGTCACAAATGTGTCCTCATCTCGAGATGAGGACACATTTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-873s1c1
Sequence:CCGGGCCTCACACATGTTCAACTCTCTCGAGAGAGTTGAACATGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-887s1c1
Sequence:CCGGCAACTCTGATACTCCAGTCCTCTCGAGAGGACTGGAGTATCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027732.1-1460s1c1
Sequence:CCGGGCAGTTTAAGATGACCCATATCTCGAGATATGGGTCATCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-483s1c1
Sequence:CCGGGCCAGGGATCCCTTCTGGAAACTCGAGTTTCCAGAAGGGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027732
DMRTC2 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family C2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027732.1-825s21c1
Sequence:CCGGAGTACTGACGGCTCCACTTTCCTCGAGGAAAGTGGAGCCGTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027732.1-1275s21c1
Sequence:CCGGACTGCAGGCACTGCATATTTGCTCGAGCAAATATGCAGTGCCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-318s1c1
Sequence:CCGGGTGTCACAAATGTGTCCTCATCTCGAGATGAGGACACATTTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-873s1c1
Sequence:CCGGGCCTCACACATGTTCAACTCTCTCGAGAGAGTTGAACATGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-887s1c1
Sequence:CCGGCAACTCTGATACTCCAGTCCTCTCGAGAGGACTGGAGTATCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027732.1-1460s1c1
Sequence:CCGGGCAGTTTAAGATGACCCATATCTCGAGATATGGGTCATCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027732.1-483s1c1
Sequence:CCGGGCCAGGGATCCCTTCTGGAAACTCGAGTTTCCAGAAGGGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033052
DMRTC2 MISSION shRNA Bacterial Glycerol Stock
DMRT-like family C2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-326s1c1
Sequence:CCGGGCAGCTAAAGAAGCACCTGATCTCGAGATCAGGTGCTTCTTTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-376s1c1
Sequence:CCGGCCAACCACTTCAGAAAGGGAACTCGAGTTCCCTTTCTGAAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-670s1c1
Sequence:CCGGCGCCTGCTGTACCAAGAACCTCTCGAGAGGTTCTTGGTACAGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-414s1c1
Sequence:CCGGCCCTCTGGAAAGGAGAACATACTCGAGTATGTTCTCCTTTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-245s1c1
Sequence:CCGGCGAGTGTCACAAATGTGTCCACTCGAGTGGACACATTTGTGACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033052
DMRTC2 MISSION shRNA shRNA Plasmid DNA
DMRT-like family C2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-326s1c1
Sequence:CCGGGCAGCTAAAGAAGCACCTGATCTCGAGATCAGGTGCTTCTTTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-376s1c1
Sequence:CCGGCCAACCACTTCAGAAAGGGAACTCGAGTTCCCTTTCTGAAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-670s1c1
Sequence:CCGGCGCCTGCTGTACCAAGAACCTCTCGAGAGGTTCTTGGTACAGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-414s1c1
Sequence:CCGGCCCTCTGGAAAGGAGAACATACTCGAGTATGTTCTCCTTTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-245s1c1
Sequence:CCGGCGAGTGTCACAAATGTGTCCACTCGAGTGGACACATTTGTGACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033052
DMRTC2 MISSION shRNA Lentiviral Transduction Particles
DMRT-like family C2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-326s1c1
Sequence:CCGGGCAGCTAAAGAAGCACCTGATCTCGAGATCAGGTGCTTCTTTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-376s1c1
Sequence:CCGGCCAACCACTTCAGAAAGGGAACTCGAGTTCCCTTTCTGAAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-670s1c1
Sequence:CCGGCGCCTGCTGTACCAAGAACCTCTCGAGAGGTTCTTGGTACAGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-414s1c1
Sequence:CCGGCCCTCTGGAAAGGAGAACATACTCGAGTATGTTCTCCTTTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033052.1-245s1c1
Sequence:CCGGCGAGTGTCACAAATGTGTCCACTCGAGTGGACACATTTGTGACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks