EMAIL THIS PAGE TO A FRIEND

DMTF1

cyclin D binding myb-like transcription factor 1

236 Gene Product Result for
Synonyms: DMP1 DMTF hDMP1
Gene ID:
Human(9988) Summary: This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(23857) cyclin D binding myb-like transcription factor 1
Rat(114485) cyclin D binding myb-like transcription factor 1
Zebrafish(436938) cyclin D binding myb-like transcription factor 1
cow(539676) cyclin D binding myb-like transcription factor 1
Horse(100049982) cyclin D binding myb-like transcription factor 1
domestic cat(101096302) cyclin D binding myb-like transcription factor 1
dog(475217) cyclin D binding myb-like transcription factor 1
chicken(418646) cyclin D binding myb-like transcription factor 1
naked mole-rat(101715156) cyclin D binding myb-like transcription factor 1
domestic guinea pig(100732106) cyclin D binding myb-like transcription factor 1
sheep(101111877) cyclin D binding myb-like transcription factor 1
Domestic Rabbit(100356192) cyclin D binding myb-like transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34602 Anti-DMTF1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rat, canine, human, mouse, horse, rabbit
western blot pricing
AV39484 Anti-DMTF1 (AB2) antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, horse, mouse, rat, bovine, rabbit
western blot pricing
HPA023846 Anti-DMTF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103494 Anti-DMTF1 antibody produced in rabbit affinity isolated antibody bovine, canine, human, rabbit, mouse, guinea pig, horse, rat
western blot pricing
SAB2103500 Anti-DMTF1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, canine, zebrafish, guinea pig, rat, horse, bovine
western blot pricing
WH0009988M3 Monoclonal Anti-DMTF1 antibody produced in mouse clone 5C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021145 Rosetta Predictions human pricing
NM_053693 Rosetta Predictions rat pricing
NM_001110327 Rosetta Predictions mouse pricing
NM_011806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354673 predicted 1109
2 SASI_Hs02_00354674 predicted 2611
3 SASI_Hs01_00160012 predicted 1484
4 SASI_Hs02_00354675 predicted 1781
5 SASI_Hs01_00160014 predicted 713
6 SASI_Hs01_00160017 predicted 2522
7 SASI_Hs02_00354676 predicted 1154
8 SASI_Hs01_00160019 predicted 920
9 SASI_Hs01_00160020 predicted 2759
10 SASI_Hs01_00160021 predicted 1013
11 SASI_Hs01_00160013 predicted 2169
12 SASI_Hs01_00160015 predicted 2426
13 SASI_Hs01_00160016 predicted 1659
14 SASI_Hs01_00160018 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030061 predicted 999
2 SASI_Rn01_00030062 predicted 2072
3 SASI_Rn01_00030063 predicted 2331
4 SASI_Rn01_00030064 predicted 1686
5 SASI_Rn01_00030065 predicted 1800
6 SASI_Rn02_00266453 predicted 1319
7 SASI_Rn01_00030067 predicted 2064
8 SASI_Rn01_00030068 predicted 1446
9 SASI_Rn01_00030069 predicted 464
10 SASI_Rn01_00030070 predicted 783
11 SASI_Rn01_00030066 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305418 predicted 2281
2 SASI_Mm02_00305419 predicted 2146
3 SASI_Mm02_00305420 predicted 1759
4 SASI_Mm02_00305421 predicted 2334
5 SASI_Mm02_00305422 predicted 2189
6 SASI_Mm02_00305423 predicted 1704
7 SASI_Mm02_00305424 predicted 2096
8 SASI_Mm02_00305425 predicted 798
9 SASI_Mm02_00305426 predicted 2395
10 SASI_Mm02_00305427 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108922 predicted 2493
2 SASI_Mm01_00108924 predicted 2357
3 SASI_Mm01_00108925 predicted 1963
4 SASI_Mm02_00321488 predicted 2541
5 SASI_Mm02_00321489 predicted 2405
6 SASI_Mm01_00108926 predicted 1917
7 SASI_Mm02_00321490 predicted 2308
8 SASI_Mm01_00108928 predicted 801
9 SASI_Mm01_00108929 predicted 2601
10 SASI_Mm01_00108930 predicted 933
11 SASI_Mm01_00108923 predicted 1683
12 SASI_Mm01_00108927 predicted 2503
13 SASI_Mm01_00108931 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021145
VALIDATED
DMTF1 MISSION shRNA Bacterial Glycerol Stock
cyclin D binding myb-like transcription factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021145.1-3248s1c1
Sequence:CCGGCCACTGTCATTAGTTTACAAACTCGAGTTTGTAAACTAATGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2248s1c1
Sequence:CCGGCCGACCTTAAACAAGAGGAATCTCGAGATTCCTCTTGTTTAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-375s1c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2148s1c1
Sequence:CCGGCCATCATTTAATGATGCTCATCTCGAGATGAGCATCATTAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-888s1c1
Sequence:CCGGCGGCCTTTGTTTGCAGTTTATCTCGAGATAAACTGCAAACAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1290s21c1
Sequence:CCGGGGCAATGACTGGGCAACAATACTCGAGTATTGTTGCCCAGTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021145.3-3318s21c1
Sequence:CCGGCTTGACCAGCATACAAGTATACTCGAGTATACTTGTATGCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021145.3-1076s21c1
Sequence:CCGGTCTTAAGGCACGCGGAATAAACTCGAGTTTATTCCGCGTGCCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1692s21c1
Sequence:CCGGCCACAATGGCTACGAAGTAAACTCGAGTTTACTTCGTAGCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-663s21c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-983s21c1
Sequence:CCGGTAAGGATTCTCTGACTAATAACTCGAGTTATTAGTCAGAGAATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021145
VALIDATED
DMTF1 MISSION shRNA shRNA Plasmid DNA
cyclin D binding myb-like transcription factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021145.1-3248s1c1
Sequence:CCGGCCACTGTCATTAGTTTACAAACTCGAGTTTGTAAACTAATGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2248s1c1
Sequence:CCGGCCGACCTTAAACAAGAGGAATCTCGAGATTCCTCTTGTTTAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-375s1c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2148s1c1
Sequence:CCGGCCATCATTTAATGATGCTCATCTCGAGATGAGCATCATTAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-888s1c1
Sequence:CCGGCGGCCTTTGTTTGCAGTTTATCTCGAGATAAACTGCAAACAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1290s21c1
Sequence:CCGGGGCAATGACTGGGCAACAATACTCGAGTATTGTTGCCCAGTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021145.3-3318s21c1
Sequence:CCGGCTTGACCAGCATACAAGTATACTCGAGTATACTTGTATGCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021145.3-1076s21c1
Sequence:CCGGTCTTAAGGCACGCGGAATAAACTCGAGTTTATTCCGCGTGCCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1692s21c1
Sequence:CCGGCCACAATGGCTACGAAGTAAACTCGAGTTTACTTCGTAGCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-663s21c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-983s21c1
Sequence:CCGGTAAGGATTCTCTGACTAATAACTCGAGTTATTAGTCAGAGAATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021145
VALIDATED
DMTF1 MISSION shRNA Lentiviral Transduction Particles
cyclin D binding myb-like transcription factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021145.1-3248s1c1
Sequence:CCGGCCACTGTCATTAGTTTACAAACTCGAGTTTGTAAACTAATGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2248s1c1
Sequence:CCGGCCGACCTTAAACAAGAGGAATCTCGAGATTCCTCTTGTTTAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-375s1c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-2148s1c1
Sequence:CCGGCCATCATTTAATGATGCTCATCTCGAGATGAGCATCATTAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021145.1-888s1c1
Sequence:CCGGCGGCCTTTGTTTGCAGTTTATCTCGAGATAAACTGCAAACAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1290s21c1
Sequence:CCGGGGCAATGACTGGGCAACAATACTCGAGTATTGTTGCCCAGTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021145.3-3318s21c1
Sequence:CCGGCTTGACCAGCATACAAGTATACTCGAGTATACTTGTATGCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021145.3-1076s21c1
Sequence:CCGGTCTTAAGGCACGCGGAATAAACTCGAGTTTATTCCGCGTGCCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-1692s21c1
Sequence:CCGGCCACAATGGCTACGAAGTAAACTCGAGTTTACTTCGTAGCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-663s21c1
Sequence:CCGGCCTCAGAATGAAGCGGATGAACTCGAGTTCATCCGCTTCATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021145.3-983s21c1
Sequence:CCGGTAAGGATTCTCTGACTAATAACTCGAGTTATTAGTCAGAGAATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011806
VALIDATED
DMTF1 MISSION shRNA Bacterial Glycerol Stock
cyclin D binding myb-like transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011806.2-2890s1c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2086s1c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011806.2-1910s1c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2089s1c1
Sequence:CCGGCGGCCTAAGATGACTATACAACTCGAGTTGTATAGTCATCTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-664s1c1
Sequence:CCGGCTCACTAACAAAGGACATAAACTCGAGTTTATGTCCTTTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-2144s21c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-1968s21c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-805s21c1
Sequence:CCGGTCTGAAGGCTCGCGGAATAAACTCGAGTTTATTCCGCGAGCCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-994s21c1
Sequence:CCGGGCTCAAGGAGCTCCGGATAAACTCGAGTTTATCCGGAGCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011806.3-2948s21c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011806
VALIDATED
DMTF1 MISSION shRNA shRNA Plasmid DNA
cyclin D binding myb-like transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011806.2-2890s1c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2086s1c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011806.2-1910s1c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2089s1c1
Sequence:CCGGCGGCCTAAGATGACTATACAACTCGAGTTGTATAGTCATCTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-664s1c1
Sequence:CCGGCTCACTAACAAAGGACATAAACTCGAGTTTATGTCCTTTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-2144s21c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-1968s21c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-805s21c1
Sequence:CCGGTCTGAAGGCTCGCGGAATAAACTCGAGTTTATTCCGCGAGCCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-994s21c1
Sequence:CCGGGCTCAAGGAGCTCCGGATAAACTCGAGTTTATCCGGAGCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011806.3-2948s21c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011806
VALIDATED
DMTF1 MISSION shRNA Lentiviral Transduction Particles
cyclin D binding myb-like transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011806.2-2890s1c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2086s1c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011806.2-1910s1c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-2089s1c1
Sequence:CCGGCGGCCTAAGATGACTATACAACTCGAGTTGTATAGTCATCTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011806.2-664s1c1
Sequence:CCGGCTCACTAACAAAGGACATAAACTCGAGTTTATGTCCTTTGTTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-2144s21c1
Sequence:CCGGCCTCGGCCTAAGATGACTATACTCGAGTATAGTCATCTTAGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-1968s21c1
Sequence:CCGGGCGATAATGTCACGGTACAATCTCGAGATTGTACCGTGACATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-805s21c1
Sequence:CCGGTCTGAAGGCTCGCGGAATAAACTCGAGTTTATTCCGCGAGCCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011806.3-994s21c1
Sequence:CCGGGCTCAAGGAGCTCCGGATAAACTCGAGTTTATCCGGAGCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011806.3-2948s21c1
Sequence:CCGGGCTGGTTGTAATTCAGCTTATCTCGAGATAAGCTGAATTACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks