EMAIL THIS PAGE TO A FRIEND

DMTN

dematin actin binding protein

146 Gene Product Result for
Synonyms: DMT EPB49
Gene ID:
Human(2039) Summary: Dematin, or EPB49, is an actin-bundling protein originally identified in the erythroid membrane skeleton. Its actin-bundling activity is abolished upon phosphorylation by cAMP-dependent protein kinase and is restored after dephosphorylation (Rana et al., 1993 [PubMed 8341682]
Mouse(13829) dematin actin binding protein
Rat(361069) dematin actin binding protein
domestic guinea pig(100726620) dematin actin binding protein
naked mole-rat(101708072) dematin actin binding protein
Zebrafish(565367) dematin actin binding protein
cow(512981) erythrocyte membrane protein band 4.9 (dematin)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114135 Rosetta Predictions human pricing
NM_001114136 Rosetta Predictions human pricing
NM_001114137 Rosetta Predictions human pricing
NM_001114138 Rosetta Predictions human pricing
NM_001114139 Rosetta Predictions human pricing
NM_001978 Rosetta Predictions human pricing
NM_001108385 Rosetta Predictions rat pricing
NM_013514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326354 predicted 579
2 SASI_Hs02_00326355 predicted 574
3 SASI_Hs02_00326356 predicted 1728
4 SASI_Hs02_00326357 predicted 574
5 SASI_Hs02_00326358 predicted 667
6 SASI_Hs02_00326359 predicted 1721
7 SASI_Hs02_00326360 predicted 674
8 SASI_Hs02_00326361 predicted 656
9 SASI_Hs02_00326362 predicted 574
10 SASI_Hs02_00326363 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326364 predicted 531
2 SASI_Hs02_00326365 predicted 531
3 SASI_Hs02_00326366 predicted 1681
4 SASI_Hs02_00326367 predicted 533
5 SASI_Hs02_00326368 predicted 1675
6 SASI_Hs02_00326369 predicted 612
7 SASI_Hs02_00326370 predicted 529
8 SASI_Hs02_00326371 predicted 1543
9 SASI_Hs02_00326372 predicted 1539
10 SASI_Hs02_00326373 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326374 predicted 694
2 SASI_Hs02_00326375 predicted 685
3 SASI_Hs02_00326376 predicted 1779
4 SASI_Hs02_00326377 predicted 689
5 SASI_Hs02_00326378 predicted 1771
6 SASI_Hs02_00326379 predicted 775
7 SASI_Hs02_00326380 predicted 692
8 SASI_Hs02_00326381 predicted 1639
9 SASI_Hs02_00326382 predicted 1633
10 SASI_Hs02_00326383 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326384 predicted 662
2 SASI_Hs02_00326385 predicted 662
3 SASI_Hs02_00326386 predicted 1745
4 SASI_Hs02_00326387 predicted 664
5 SASI_Hs02_00326388 predicted 1735
6 SASI_Hs02_00326389 predicted 663
7 SASI_Hs02_00326390 predicted 1611
8 SASI_Hs02_00326391 predicted 1657
9 SASI_Hs02_00326392 predicted 1604
10 SASI_Hs02_00326393 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326394 predicted 591
2 SASI_Hs02_00326395 predicted 586
3 SASI_Hs02_00326396 predicted 1677
4 SASI_Hs02_00326397 predicted 590
5 SASI_Hs02_00326398 predicted 1671
6 SASI_Hs02_00326399 predicted 669
7 SASI_Hs02_00326400 predicted 588
8 SASI_Hs02_00326401 predicted 1532
9 SASI_Hs02_00326402 predicted 1534
10 SASI_Hs02_00326403 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332951 predicted 794
2 SASI_Hs02_00332952 predicted 789
3 SASI_Hs02_00332953 predicted 1948
4 SASI_Hs02_00332954 predicted 791
5 SASI_Hs02_00332955 predicted 893
6 SASI_Hs01_00133227 predicted 1940
7 SASI_Hs02_00332956 predicted 893
8 SASI_Hs01_00133228 predicted 879
9 SASI_Hs02_00332957 predicted 801
10 SASI_Hs01_00133229 predicted 1804
11 SASI_Hs01_00133224 predicted 1477
12 SASI_Hs01_00133225 predicted 1359
13 SASI_Hs01_00133226 predicted 1569
14 SASI_Hs01_00133230 predicted 636
15 SASI_Hs01_00133231 predicted 1558
16 SASI_Hs01_00133232 predicted 2100
17 SASI_Hs01_00133233 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238139 predicted 1358
2 SASI_Rn02_00238140 predicted 995
3 SASI_Rn02_00238141 predicted 756
4 SASI_Rn02_00238142 predicted 1280
5 SASI_Rn02_00238143 predicted 1185
6 SASI_Rn02_00238144 predicted 933
7 SASI_Rn02_00238145 predicted 880
8 SASI_Rn02_00238146 predicted 1387
9 SASI_Rn02_00238147 predicted 1158
10 SASI_Rn02_00238148 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034406 predicted 733
2 SASI_Mm01_00034407 predicted 1330
3 SASI_Mm02_00322187 predicted 1251
4 SASI_Mm01_00034408 predicted 620
5 SASI_Mm01_00034409 predicted 1159
6 SASI_Mm01_00034410 predicted 1715
7 SASI_Mm01_00034411 predicted 1368
8 SASI_Mm01_00034412 predicted 1384
9 SASI_Mm01_00034413 predicted 850
10 SASI_Mm01_00034414 predicted 915
11 SASI_Mm01_00034415 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001978
DMTN MISSION shRNA Bacterial Glycerol Stock
dematin actin binding protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1569s1c1
Sequence:CCGGCGAGGACTTCTCAAGGGTATTCTCGAGAATACCCTTGAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2565s1c1
Sequence:CCGGGCTTGACTTCTTTCCAGTCCACTCGAGTGGACTGGAAAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-645s1c1
Sequence:CCGGGCCTCACTTCACTTATTCCCTCTCGAGAGGGAATAAGTGAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-948s1c1
Sequence:CCGGCATCATCGAGTCATCCAAGTTCTCGAGAACTTGGATGACTCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1468s1c1
Sequence:CCGGCAGAAGATCTATCCCTATGAACTCGAGTTCATAGGGATAGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2484s1c1
Sequence:CCGGCTATGCTCTCTCAAGAATGTACTCGAGTACATTCTTGAGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1173s1c1
Sequence:CCGGCAGTAAGGTTACTTCCAACTTCTCGAGAAGTTGGAAGTAACCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2480s1c1
Sequence:CCGGCACACTATGCTCTCTCAAGAACTCGAGTTCTTGAGAGAGCATAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1570s1c1
Sequence:CCGGGAGGACTTCTCAAGGGTATTTCTCGAGAAATACCCTTGAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-884s1c1
Sequence:CCGGCCATCTATAAGCAGAGAGAGTCTCGAGACTCTCTCTGCTTATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1481s1c1
Sequence:CCGGCCTATGAAATGCTAGTGGTGACTCGAGTCACCACTAGCATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001978
DMTN MISSION shRNA shRNA Plasmid DNA
dematin actin binding protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1569s1c1
Sequence:CCGGCGAGGACTTCTCAAGGGTATTCTCGAGAATACCCTTGAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2565s1c1
Sequence:CCGGGCTTGACTTCTTTCCAGTCCACTCGAGTGGACTGGAAAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-645s1c1
Sequence:CCGGGCCTCACTTCACTTATTCCCTCTCGAGAGGGAATAAGTGAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-948s1c1
Sequence:CCGGCATCATCGAGTCATCCAAGTTCTCGAGAACTTGGATGACTCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1468s1c1
Sequence:CCGGCAGAAGATCTATCCCTATGAACTCGAGTTCATAGGGATAGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2484s1c1
Sequence:CCGGCTATGCTCTCTCAAGAATGTACTCGAGTACATTCTTGAGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1173s1c1
Sequence:CCGGCAGTAAGGTTACTTCCAACTTCTCGAGAAGTTGGAAGTAACCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2480s1c1
Sequence:CCGGCACACTATGCTCTCTCAAGAACTCGAGTTCTTGAGAGAGCATAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1570s1c1
Sequence:CCGGGAGGACTTCTCAAGGGTATTTCTCGAGAAATACCCTTGAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-884s1c1
Sequence:CCGGCCATCTATAAGCAGAGAGAGTCTCGAGACTCTCTCTGCTTATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1481s1c1
Sequence:CCGGCCTATGAAATGCTAGTGGTGACTCGAGTCACCACTAGCATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001978
DMTN MISSION shRNA Lentiviral Transduction Particles
dematin actin binding protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1569s1c1
Sequence:CCGGCGAGGACTTCTCAAGGGTATTCTCGAGAATACCCTTGAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2565s1c1
Sequence:CCGGGCTTGACTTCTTTCCAGTCCACTCGAGTGGACTGGAAAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-645s1c1
Sequence:CCGGGCCTCACTTCACTTATTCCCTCTCGAGAGGGAATAAGTGAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-948s1c1
Sequence:CCGGCATCATCGAGTCATCCAAGTTCTCGAGAACTTGGATGACTCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1468s1c1
Sequence:CCGGCAGAAGATCTATCCCTATGAACTCGAGTTCATAGGGATAGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2484s1c1
Sequence:CCGGCTATGCTCTCTCAAGAATGTACTCGAGTACATTCTTGAGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001978.1-1173s1c1
Sequence:CCGGCAGTAAGGTTACTTCCAACTTCTCGAGAAGTTGGAAGTAACCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001978.1-2480s1c1
Sequence:CCGGCACACTATGCTCTCTCAAGAACTCGAGTTCTTGAGAGAGCATAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1570s1c1
Sequence:CCGGGAGGACTTCTCAAGGGTATTTCTCGAGAAATACCCTTGAGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-884s1c1
Sequence:CCGGCCATCTATAAGCAGAGAGAGTCTCGAGACTCTCTCTGCTTATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001978.1-1481s1c1
Sequence:CCGGCCTATGAAATGCTAGTGGTGACTCGAGTCACCACTAGCATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013514
DMTN MISSION shRNA Bacterial Glycerol Stock
dematin actin binding protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013514.2-2196s1c1
Sequence:CCGGGCTTATTCAAAGCTGTGGCTACTCGAGTAGCCACAGCTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-915s1c1
Sequence:CCGGCCTCATCATCGAATCCTCCAACTCGAGTTGGAGGATTCGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-918s1c1
Sequence:CCGGCATCATCGAATCCTCCAAGTTCTCGAGAACTTGGAGGATTCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-825s1c1
Sequence:CCGGCCCGGATTCCAACATCTACAACTCGAGTTGTAGATGTTGGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013514
DMTN MISSION shRNA shRNA Plasmid DNA
dematin actin binding protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013514.2-2196s1c1
Sequence:CCGGGCTTATTCAAAGCTGTGGCTACTCGAGTAGCCACAGCTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-915s1c1
Sequence:CCGGCCTCATCATCGAATCCTCCAACTCGAGTTGGAGGATTCGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-918s1c1
Sequence:CCGGCATCATCGAATCCTCCAAGTTCTCGAGAACTTGGAGGATTCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-825s1c1
Sequence:CCGGCCCGGATTCCAACATCTACAACTCGAGTTGTAGATGTTGGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013514
DMTN MISSION shRNA Lentiviral Transduction Particles
dematin actin binding protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013514.2-2196s1c1
Sequence:CCGGGCTTATTCAAAGCTGTGGCTACTCGAGTAGCCACAGCTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-915s1c1
Sequence:CCGGCCTCATCATCGAATCCTCCAACTCGAGTTGGAGGATTCGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-918s1c1
Sequence:CCGGCATCATCGAATCCTCCAAGTTCTCGAGAACTTGGAGGATTCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013514.2-825s1c1
Sequence:CCGGCCCGGATTCCAACATCTACAACTCGAGTTGTAGATGTTGGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks