EMAIL THIS PAGE TO A FRIEND

DMWD

dystrophia myotonica, WD repeat containing

72 Gene Product Result for
Synonyms: D19S593E DMR-N9 DMRN9 gene59
UniProtKB ID: Q09019
Gene ID:
Mouse(13401) dystrophia myotonica-containing WD repeat motif
Rat(680252) dystrophia myotonica, WD repeat containing
cow(790091) dystrophia myotonica, WD repeat containing
domestic cat(101081686) dystrophia myotonica, WD repeat containing
dog(484435) dystrophia myotonica, WD repeat containing
naked mole-rat(101702402) dystrophia myotonica, WD repeat containing
domestic guinea pig(100713808) dystrophia myotonica, WD repeat containing
sheep(101118634) dystrophia myotonica, WD repeat containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150401 MISSION® esiRNA esiRNA human DMWD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004943 Rosetta Predictions human pricing
XM_001056337 Rosetta Predictions rat pricing
NM_010058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201187 predicted 2317
2 SASI_Hs01_00201188 predicted 2475
3 SASI_Hs01_00201189 predicted 1081
4 SASI_Hs01_00201191 predicted 1141
5 SASI_Hs01_00201192 predicted 2539
6 SASI_Hs01_00201193 predicted 613
7 SASI_Hs01_00201194 predicted 2469
8 SASI_Hs02_00338615 predicted 664
9 SASI_Hs01_00201195 predicted 968
10 SASI_Hs01_00201196 predicted 665
11 SASI_Hs01_00201190 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282970 predicted 910
2 SASI_Rn02_00282971 predicted 991
3 SASI_Rn02_00282972 predicted 2057
4 SASI_Rn02_00282973 predicted 1800
5 SASI_Rn02_00282974 predicted 544
6 SASI_Rn02_00282975 predicted 819
7 SASI_Rn02_00282976 predicted 534
8 SASI_Rn02_00282977 predicted 462
9 SASI_Rn02_00282978 predicted 1922
10 SASI_Rn02_00282979 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317716 predicted 1708
2 SASI_Mm01_00072087 predicted 913
3 SASI_Mm01_00072088 predicted 1260
4 SASI_Mm01_00072089 predicted 829
5 SASI_Mm01_00072090 predicted 915
6 SASI_Mm01_00072091 predicted 674
7 SASI_Mm01_00072092 predicted 1865
8 SASI_Mm01_00072093 predicted 2060
9 SASI_Mm01_00072094 predicted 1458
10 SASI_Mm01_00072096 predicted 1715
11 SASI_Mm01_00072095 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004943
VALIDATED
DMWD MISSION shRNA Bacterial Glycerol Stock
dystrophia myotonica, WD repeat containing
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-502s1c1
Sequence:CCGGCAAGCCAATTGACAAGCGGATCTCGAGATCCGCTTGTCAATTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-133s1c1
Sequence:CCGGCGAGGGTTTCTACAAGCTACTCTCGAGAGTAGCTTGTAGAAACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-496s1c1
Sequence:CCGGCCTCAACAAGCCAATTGACAACTCGAGTTGTCAATTGGCTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004943.1-3095s1c1
Sequence:CCGGCCGAAATGTTTCTGTTTCTAACTCGAGTTAGAAACAGAAACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-551s1c1
Sequence:CCGGGATTTCAACCAGTTCACTGCTCTCGAGAGCAGTGAACTGGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-490s1c1
Sequence:CCGGCATTGACCTCAACAAGCCAATCTCGAGATTGGCTTGTTGAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-440s1c1
Sequence:CCGGCGTGAGCTCTATTTCTACCCACTCGAGTGGGTAGAAATAGAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004943
VALIDATED
DMWD MISSION shRNA shRNA Plasmid DNA
dystrophia myotonica, WD repeat containing
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-502s1c1
Sequence:CCGGCAAGCCAATTGACAAGCGGATCTCGAGATCCGCTTGTCAATTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-133s1c1
Sequence:CCGGCGAGGGTTTCTACAAGCTACTCTCGAGAGTAGCTTGTAGAAACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-496s1c1
Sequence:CCGGCCTCAACAAGCCAATTGACAACTCGAGTTGTCAATTGGCTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004943.1-3095s1c1
Sequence:CCGGCCGAAATGTTTCTGTTTCTAACTCGAGTTAGAAACAGAAACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-551s1c1
Sequence:CCGGGATTTCAACCAGTTCACTGCTCTCGAGAGCAGTGAACTGGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-490s1c1
Sequence:CCGGCATTGACCTCAACAAGCCAATCTCGAGATTGGCTTGTTGAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-440s1c1
Sequence:CCGGCGTGAGCTCTATTTCTACCCACTCGAGTGGGTAGAAATAGAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004943
VALIDATED
DMWD MISSION shRNA Lentiviral Transduction Particles
dystrophia myotonica, WD repeat containing
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-502s1c1
Sequence:CCGGCAAGCCAATTGACAAGCGGATCTCGAGATCCGCTTGTCAATTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-133s1c1
Sequence:CCGGCGAGGGTTTCTACAAGCTACTCTCGAGAGTAGCTTGTAGAAACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-496s1c1
Sequence:CCGGCCTCAACAAGCCAATTGACAACTCGAGTTGTCAATTGGCTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004943.1-3095s1c1
Sequence:CCGGCCGAAATGTTTCTGTTTCTAACTCGAGTTAGAAACAGAAACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-551s1c1
Sequence:CCGGGATTTCAACCAGTTCACTGCTCTCGAGAGCAGTGAACTGGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004943.1-490s1c1
Sequence:CCGGCATTGACCTCAACAAGCCAATCTCGAGATTGGCTTGTTGAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004943.1-440s1c1
Sequence:CCGGCGTGAGCTCTATTTCTACCCACTCGAGTGGGTAGAAATAGAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010058
VALIDATED
DMWD MISSION shRNA Bacterial Glycerol Stock
dystrophia myotonica, WD repeat containing
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010058.1-649s1c1
Sequence:CCGGCATCAAGAAAGACACCAGCAACTCGAGTTGCTGGTGTCTTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-2287s1c1
Sequence:CCGGGTTCTCTGAAACATCAGTGTTCTCGAGAACACTGATGTTTCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-994s1c1
Sequence:CCGGCCACTTTGACAGCATGCTTCTCTCGAGAGAAGCATGCTGTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1586s1c1
Sequence:CCGGCCTGGCATACCATTCAGCATTCTCGAGAATGCTGAATGGTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-505s1c1
Sequence:CCGGCATCGATCTCAACAAGCCCATCTCGAGATGGGCTTGTTGAGATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1831s1c1
Sequence:CCGGCGTGTGCAAGAAGATTGCTCACTCGAGTGAGCAATCTTCTTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010058
VALIDATED
DMWD MISSION shRNA shRNA Plasmid DNA
dystrophia myotonica, WD repeat containing
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010058.1-649s1c1
Sequence:CCGGCATCAAGAAAGACACCAGCAACTCGAGTTGCTGGTGTCTTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-2287s1c1
Sequence:CCGGGTTCTCTGAAACATCAGTGTTCTCGAGAACACTGATGTTTCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-994s1c1
Sequence:CCGGCCACTTTGACAGCATGCTTCTCTCGAGAGAAGCATGCTGTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1586s1c1
Sequence:CCGGCCTGGCATACCATTCAGCATTCTCGAGAATGCTGAATGGTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-505s1c1
Sequence:CCGGCATCGATCTCAACAAGCCCATCTCGAGATGGGCTTGTTGAGATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1831s1c1
Sequence:CCGGCGTGTGCAAGAAGATTGCTCACTCGAGTGAGCAATCTTCTTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010058
VALIDATED
DMWD MISSION shRNA Lentiviral Transduction Particles
dystrophia myotonica, WD repeat containing
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010058.1-649s1c1
Sequence:CCGGCATCAAGAAAGACACCAGCAACTCGAGTTGCTGGTGTCTTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-2287s1c1
Sequence:CCGGGTTCTCTGAAACATCAGTGTTCTCGAGAACACTGATGTTTCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-994s1c1
Sequence:CCGGCCACTTTGACAGCATGCTTCTCTCGAGAGAAGCATGCTGTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1586s1c1
Sequence:CCGGCCTGGCATACCATTCAGCATTCTCGAGAATGCTGAATGGTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-505s1c1
Sequence:CCGGCATCGATCTCAACAAGCCCATCTCGAGATGGGCTTGTTGAGATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010058.1-1831s1c1
Sequence:CCGGCGTGTGCAAGAAGATTGCTCACTCGAGTGAGCAATCTTCTTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks