EMAIL THIS PAGE TO A FRIEND

DMXL1

Dmx-like 1

169 Gene Product Result for
UniProtKB ID: Q9Y485
Gene ID:
Human(1657) Summary: The protein encoded by this gene is a member of a superfamily of WD repeat proteins. The function of this protein is not yet determined; however, other related family members perform functions involved in regulatory processes. [provided by RefSeq, Jul 2008]
Mouse(240283) Dmx-like 1
Rat(307429) Dmx-like 1
sheep(101115363) Dmx-like 1
Zebrafish(336886) Dmx-like 1
Horse(100064119) Dmx-like 1
dog(474631) Dmx-like 1
chicken(427385) Dmx-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005509 Rosetta Predictions human pricing
NM_001107388 Rosetta Predictions rat pricing
NM_001081371 Rosetta Predictions mouse pricing
XM_283496 Rosetta Predictions mouse pricing
XM_901441 Rosetta Predictions mouse pricing
XM_901445 Rosetta Predictions mouse pricing
XM_901449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244874 predicted 4645
2 SASI_Hs02_00339719 predicted 283
3 SASI_Hs02_00339720 predicted 4850
4 SASI_Hs01_00244876 predicted 7195
5 SASI_Hs02_00339721 predicted 8069
6 SASI_Hs02_00339722 predicted 1995
7 SASI_Hs01_00244878 predicted 4453
8 SASI_Hs01_00244879 predicted 2140
9 SASI_Hs01_00244880 predicted 572
10 SASI_Hs02_00339723 predicted 8312
11 SASI_Hs01_00244875 predicted 4116
12 SASI_Hs01_00244877 predicted 6256
13 SASI_Hs01_00244881 predicted 3334
14 SASI_Hs01_00244882 predicted 5281
15 SASI_Hs01_00244883 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228325 predicted 291
2 SASI_Rn02_00228326 predicted 193
3 SASI_Rn02_00228327 predicted 231
4 SASI_Rn02_00228328 predicted 297
5 SASI_Rn02_00228329 predicted 260
6 SASI_Rn02_00228330 predicted 264
7 SASI_Rn02_00228331 predicted 298
8 SASI_Rn02_00228332 predicted 292
9 SASI_Rn02_00228333 predicted 240
10 SASI_Rn02_00228334 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297761 predicted 4610
2 SASI_Mm02_00297762 predicted 3388
3 SASI_Mm02_00297763 predicted 6647
4 SASI_Mm02_00297764 predicted 1961
5 SASI_Mm02_00297765 predicted 4490
6 SASI_Mm02_00297766 predicted 1996
7 SASI_Mm02_00297767 predicted 4670
8 SASI_Mm02_00297768 predicted 3810
9 SASI_Mm02_00297769 predicted 1611
10 SASI_Mm02_00297770 predicted 2874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284809 predicted 7013
2 SASI_Mm01_00284810 predicted 4641
3 SASI_Mm01_00284811 predicted 7945
4 SASI_Mm01_00284812 predicted 2011
5 SASI_Mm01_00284813 predicted 4694
6 SASI_Mm01_00284814 predicted 3834
7 SASI_Mm01_00284815 predicted 2898
8 SASI_Mm01_00284816 predicted 2399
9 SASI_Mm01_00284817 predicted 8281
10 SASI_Mm01_00284818 predicted 7322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260963 predicted 816
2 SASI_Mm01_00260964 predicted 215
3 SASI_Mm01_00260965 predicted 1008
4 SASI_Mm01_00260966 predicted 1029
5 SASI_Mm01_00260967 predicted 1221
6 SASI_Mm01_00260968 predicted 1149
7 SASI_Mm01_00260969 predicted 254
8 SASI_Mm01_00260970 predicted 290
9 SASI_Mm01_00260971 predicted 717
10 SASI_Mm01_00260972 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243736 predicted 1965
2 SASI_Mm01_00243737 predicted 816
3 SASI_Mm01_00243738 predicted 1007
4 SASI_Mm01_00243739 predicted 1035
5 SASI_Mm01_00243740 predicted 1612
6 SASI_Mm01_00243741 predicted 2431
7 SASI_Mm01_00243742 predicted 248
8 SASI_Mm01_00243743 predicted 1768
9 SASI_Mm01_00243744 predicted 1039
10 SASI_Mm01_00243745 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230581 predicted 4617
2 SASI_Mm01_00230582 predicted 6652
3 SASI_Mm01_00230583 predicted 1961
4 SASI_Mm01_00230584 predicted 7966
5 SASI_Mm01_00230585 predicted 4489
6 SASI_Mm01_00230586 predicted 1993
7 SASI_Mm01_00230587 predicted 4674
8 SASI_Mm01_00230588 predicted 3814
9 SASI_Mm01_00230589 predicted 2888
10 SASI_Mm01_00230590 predicted 2385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005509
VALIDATED
DMXL1 MISSION shRNA Bacterial Glycerol Stock
Dmx-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-6204s1c1
Sequence:CCGGCGTACTTTATCTACTGGCTATCTCGAGATAGCCAGTAGATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-417s1c1
Sequence:CCGGGCACACAATATAACCTGGGATCTCGAGATCCCAGGTTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-297s1c1
Sequence:CCGGGCAGCGTCTTATGGAAATGTTCTCGAGAACATTTCCATAAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005509.3-978s1c1
Sequence:CCGGGCTTCCAGTAAAGAACGAGTTCTCGAGAACTCGTTCTTTACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-6664s1c1
Sequence:CCGGCCAATCCATTATTGCACCTTACTCGAGTAAGGTGCAATAATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-3417s1c1
Sequence:CCGGGATAGCAATTTAGTGGCCTATCTCGAGATAGGCCACTAAATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-9105s1c1
Sequence:CCGGCCAGATCAGTTTAGCCCTTTACTCGAGTAAAGGGCTAAACTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6800s21c1
Sequence:CCGGGATATTCTCCATGCCATAATACTCGAGTATTATGGCATGGAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6757s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-8594s21c1
Sequence:CCGGGTTGATGCTGATGGATATTTACTCGAGTAAATATCCATCAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005509
VALIDATED
DMXL1 MISSION shRNA shRNA Plasmid DNA
Dmx-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-6204s1c1
Sequence:CCGGCGTACTTTATCTACTGGCTATCTCGAGATAGCCAGTAGATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-417s1c1
Sequence:CCGGGCACACAATATAACCTGGGATCTCGAGATCCCAGGTTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-297s1c1
Sequence:CCGGGCAGCGTCTTATGGAAATGTTCTCGAGAACATTTCCATAAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005509.3-978s1c1
Sequence:CCGGGCTTCCAGTAAAGAACGAGTTCTCGAGAACTCGTTCTTTACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-6664s1c1
Sequence:CCGGCCAATCCATTATTGCACCTTACTCGAGTAAGGTGCAATAATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-3417s1c1
Sequence:CCGGGATAGCAATTTAGTGGCCTATCTCGAGATAGGCCACTAAATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-9105s1c1
Sequence:CCGGCCAGATCAGTTTAGCCCTTTACTCGAGTAAAGGGCTAAACTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6800s21c1
Sequence:CCGGGATATTCTCCATGCCATAATACTCGAGTATTATGGCATGGAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6757s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-8594s21c1
Sequence:CCGGGTTGATGCTGATGGATATTTACTCGAGTAAATATCCATCAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005509
VALIDATED
DMXL1 MISSION shRNA Lentiviral Transduction Particles
Dmx-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-6204s1c1
Sequence:CCGGCGTACTTTATCTACTGGCTATCTCGAGATAGCCAGTAGATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-417s1c1
Sequence:CCGGGCACACAATATAACCTGGGATCTCGAGATCCCAGGTTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-297s1c1
Sequence:CCGGGCAGCGTCTTATGGAAATGTTCTCGAGAACATTTCCATAAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005509.3-978s1c1
Sequence:CCGGGCTTCCAGTAAAGAACGAGTTCTCGAGAACTCGTTCTTTACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-6664s1c1
Sequence:CCGGCCAATCCATTATTGCACCTTACTCGAGTAAGGTGCAATAATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005509.3-3417s1c1
Sequence:CCGGGATAGCAATTTAGTGGCCTATCTCGAGATAGGCCACTAAATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005509.3-9105s1c1
Sequence:CCGGCCAGATCAGTTTAGCCCTTTACTCGAGTAAAGGGCTAAACTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6800s21c1
Sequence:CCGGGATATTCTCCATGCCATAATACTCGAGTATTATGGCATGGAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-6757s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005509.4-8594s21c1
Sequence:CCGGGTTGATGCTGATGGATATTTACTCGAGTAAATATCCATCAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081371
VALIDATED
DMXL1 MISSION shRNA Bacterial Glycerol Stock
Dmx-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081371.1-9848s21c1
Sequence:CCGGCACCTACTGCCGCAGTATAAACTCGAGTTTATACTGCGGCAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-4676s21c1
Sequence:CCGGTCTAGACGAGTGCGGATTAAACTCGAGTTTAATCCGCACTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6171s21c1
Sequence:CCGGACCGTAGAACTTCGTACTTTACTCGAGTAAAGTACGAAGTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-3236s21c1
Sequence:CCGGTCGCTTAGCAGTAGCTTATAACTCGAGTTATAAGCTACTGCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6635s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081371
VALIDATED
DMXL1 MISSION shRNA shRNA Plasmid DNA
Dmx-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081371.1-9848s21c1
Sequence:CCGGCACCTACTGCCGCAGTATAAACTCGAGTTTATACTGCGGCAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-4676s21c1
Sequence:CCGGTCTAGACGAGTGCGGATTAAACTCGAGTTTAATCCGCACTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6171s21c1
Sequence:CCGGACCGTAGAACTTCGTACTTTACTCGAGTAAAGTACGAAGTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-3236s21c1
Sequence:CCGGTCGCTTAGCAGTAGCTTATAACTCGAGTTATAAGCTACTGCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6635s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081371
VALIDATED
DMXL1 MISSION shRNA Lentiviral Transduction Particles
Dmx-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081371.1-9848s21c1
Sequence:CCGGCACCTACTGCCGCAGTATAAACTCGAGTTTATACTGCGGCAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-4676s21c1
Sequence:CCGGTCTAGACGAGTGCGGATTAAACTCGAGTTTAATCCGCACTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6171s21c1
Sequence:CCGGACCGTAGAACTTCGTACTTTACTCGAGTAAAGTACGAAGTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-3236s21c1
Sequence:CCGGTCGCTTAGCAGTAGCTTATAACTCGAGTTATAAGCTACTGCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081371.1-6635s21c1
Sequence:CCGGAGTAGTTGCCAATCCATTATTCTCGAGAATAATGGATTGGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks