EMAIL THIS PAGE TO A FRIEND

DMXL2

Dmx-like 2

143 Gene Product Result for
Synonyms: RC3
UniProtKB ID: Q8TDJ6, B2RTR3, B7ZMH3, F5GWF1, O94938
Gene ID:
Human(23312) Summary: This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(235380) Dmx-like 2
Rat(315676) Dmx-like 2
Zebrafish(569435) Dmx-like 2
chicken(415594) Dmx-like 2
Horse(100055186) Dmx-like 2
cow(782535) Dmx-like 2
dog(478306) Dmx-like 2
sheep(101105079) Dmx-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015263 Rosetta Predictions human pricing
XM_001075770 Rosetta Predictions rat pricing
NM_172771 Rosetta Predictions mouse pricing
XM_358382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170910 predicted 4846
2 SASI_Hs01_00170911 predicted 3278
3 SASI_Hs02_00347412 predicted 7087
4 SASI_Hs02_00347413 predicted 1659
5 SASI_Hs01_00170914 predicted 7316
6 SASI_Hs01_00170915 predicted 2591
7 SASI_Hs01_00170916 predicted 2967
8 SASI_Hs01_00170917 predicted 2154
9 SASI_Hs02_00347414 predicted 2324
10 SASI_Hs02_00347415 predicted 6674
11 SASI_Hs01_00170909 predicted 3985
12 SASI_Hs01_00170912 predicted 2460
13 SASI_Hs01_00170913 predicted 4266
14 SASI_Hs01_00170918 predicted 3865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350971 predicted 4506
2 SASI_Rn02_00350972 predicted 7034
3 SASI_Rn02_00350973 predicted 4756
4 SASI_Rn02_00350974 predicted 2150
5 SASI_Rn02_00350975 predicted 1846
6 SASI_Rn02_00350976 predicted 4623
7 SASI_Rn02_00350977 predicted 3876
8 SASI_Rn02_00350978 predicted 6904
9 SASI_Rn02_00350979 predicted 2374
10 SASI_Rn02_00350980 predicted 2597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344656 predicted 6542
2 SASI_Mm02_00344657 predicted 1650
3 SASI_Mm02_00344658 predicted 4546
4 SASI_Mm02_00344659 predicted 4243
5 SASI_Mm02_00344660 predicted 8753
6 SASI_Mm02_00344661 predicted 7676
7 SASI_Mm02_00344662 predicted 4244
8 SASI_Mm02_00344663 predicted 7086
9 SASI_Mm02_00344664 predicted 7265
10 SASI_Mm02_00344665 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259989 predicted 4999
2 SASI_Mm01_00259990 predicted 1739
3 SASI_Mm01_00259991 predicted 4696
4 SASI_Mm01_00259992 predicted 9216
5 SASI_Mm01_00259993 predicted 8133
6 SASI_Mm01_00259994 predicted 4706
7 SASI_Mm01_00259995 predicted 7548
8 SASI_Mm01_00259996 predicted 9155
9 SASI_Mm01_00259997 predicted 4305
10 SASI_Mm01_00259998 predicted 7729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015263
VALIDATED
DMXL2 MISSION shRNA Bacterial Glycerol Stock
Dmx-like 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-8785s21c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-1715s21c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-7846s21c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-6472s21c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-5470s1c1
Sequence:CCGGGCCCGTTTATATGAATCTGAACTCGAGTTCAGATTCATATAAACGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-4092s1c1
Sequence:CCGGGCAAGATCATTCGACCTTTAACTCGAGTTAAAGGTCGAATGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-7828s1c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-6454s1c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-8767s1c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-9363s1c1
Sequence:CCGGCTACAGTCATCACTAGGCAATCTCGAGATTGCCTAGTGATGACTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-1697s1c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-2507s1c1
Sequence:CCGGCCAGTTACTGTCTAGGCACATCTCGAGATGTGCCTAGACAGTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-3016s1c1
Sequence:CCGGCCTGGACAGAAGAACGTAGATCTCGAGATCTACGTTCTTCTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015263
VALIDATED
DMXL2 MISSION shRNA shRNA Plasmid DNA
Dmx-like 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-8785s21c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-1715s21c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-7846s21c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-6472s21c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-5470s1c1
Sequence:CCGGGCCCGTTTATATGAATCTGAACTCGAGTTCAGATTCATATAAACGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-4092s1c1
Sequence:CCGGGCAAGATCATTCGACCTTTAACTCGAGTTAAAGGTCGAATGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-7828s1c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-6454s1c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-8767s1c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-9363s1c1
Sequence:CCGGCTACAGTCATCACTAGGCAATCTCGAGATTGCCTAGTGATGACTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-1697s1c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-2507s1c1
Sequence:CCGGCCAGTTACTGTCTAGGCACATCTCGAGATGTGCCTAGACAGTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-3016s1c1
Sequence:CCGGCCTGGACAGAAGAACGTAGATCTCGAGATCTACGTTCTTCTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015263
VALIDATED
DMXL2 MISSION shRNA Lentiviral Transduction Particles
Dmx-like 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-8785s21c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-1715s21c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-7846s21c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015263.2-6472s21c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-5470s1c1
Sequence:CCGGGCCCGTTTATATGAATCTGAACTCGAGTTCAGATTCATATAAACGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-4092s1c1
Sequence:CCGGGCAAGATCATTCGACCTTTAACTCGAGTTAAAGGTCGAATGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-7828s1c1
Sequence:CCGGCCATTAGGTATTGCTGTGATTCTCGAGAATCACAGCAATACCTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-6454s1c1
Sequence:CCGGGCCTTGCATGAGATATGTAATCTCGAGATTACATATCTCATGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015263.1-8767s1c1
Sequence:CCGGGCCACAAGTGACTTTGCATTTCTCGAGAAATGCAAAGTCACTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015263.1-9363s1c1
Sequence:CCGGCTACAGTCATCACTAGGCAATCTCGAGATTGCCTAGTGATGACTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015263.1-1697s1c1
Sequence:CCGGCGCTGCTAACTGAATGGAATACTCGAGTATTCCATTCAGTTAGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-2507s1c1
Sequence:CCGGCCAGTTACTGTCTAGGCACATCTCGAGATGTGCCTAGACAGTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015263.1-3016s1c1
Sequence:CCGGCCTGGACAGAAGAACGTAGATCTCGAGATCTACGTTCTTCTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172771
VALIDATED
DMXL2 MISSION shRNA Bacterial Glycerol Stock
Dmx-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-7288s21c1
Sequence:CCGGCTTGCAGCCCACCCGTTAAATCTCGAGATTTAACGGGTGGGCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-3214s21c1
Sequence:CCGGGTGTGCCTTGCACCTTATTTACTCGAGTAAATAAGGTGCAAGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-5439s21c1
Sequence:CCGGCATGGTTATTGCCCGTTTATTCTCGAGAATAAACGGGCAATAACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-10233s21c1
Sequence:CCGGATAAACTATGCAGCGTTAAATCTCGAGATTTAACGCTGCATAGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172771.2-9193s21c1
Sequence:CCGGCATGCTAAGCAGTCCATATTTCTCGAGAAATATGGACTGCTTAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172771
VALIDATED
DMXL2 MISSION shRNA shRNA Plasmid DNA
Dmx-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-7288s21c1
Sequence:CCGGCTTGCAGCCCACCCGTTAAATCTCGAGATTTAACGGGTGGGCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-3214s21c1
Sequence:CCGGGTGTGCCTTGCACCTTATTTACTCGAGTAAATAAGGTGCAAGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-5439s21c1
Sequence:CCGGCATGGTTATTGCCCGTTTATTCTCGAGAATAAACGGGCAATAACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-10233s21c1
Sequence:CCGGATAAACTATGCAGCGTTAAATCTCGAGATTTAACGCTGCATAGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172771.2-9193s21c1
Sequence:CCGGCATGCTAAGCAGTCCATATTTCTCGAGAAATATGGACTGCTTAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172771
VALIDATED
DMXL2 MISSION shRNA Lentiviral Transduction Particles
Dmx-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-7288s21c1
Sequence:CCGGCTTGCAGCCCACCCGTTAAATCTCGAGATTTAACGGGTGGGCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-3214s21c1
Sequence:CCGGGTGTGCCTTGCACCTTATTTACTCGAGTAAATAAGGTGCAAGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-5439s21c1
Sequence:CCGGCATGGTTATTGCCCGTTTATTCTCGAGAATAAACGGGCAATAACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172771.2-10233s21c1
Sequence:CCGGATAAACTATGCAGCGTTAAATCTCGAGATTTAACGCTGCATAGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172771.2-9193s21c1
Sequence:CCGGCATGCTAAGCAGTCCATATTTCTCGAGAAATATGGACTGCTTAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)