EMAIL THIS PAGE TO A FRIEND

DNA2

DNA replication helicase/nuclease 2

75 Gene Product Result for
Synonyms: DNA2L PEOA6 hDNA2
Gene ID:
Human(1763) Summary: DNA2 is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability (Duxin et al., 2009 [PubMed 19487465]
Mouse(327762) DNA replication helicase 2 homolog (yeast)
Rat(309762) DNA replication helicase/nuclease 2
Zebrafish(559535) DNA replication helicase 2 homolog (yeast)
chicken(423688) DNA replication helicase 2 homolog (yeast)
cow(540969) DNA replication helicase 2 homolog (yeast)
Horse(100072606) DNA replication helicase 2 homolog (yeast)
domestic cat(101097671) DNA replication helicase 2 homolog (yeast)
dog(489015) DNA replication helicase 2 homolog (yeast)
sheep(101105877) DNA replication helicase 2 homolog (yeast)
domestic guinea pig(100718416) DNA replication helicase/nuclease 2
naked mole-rat(101702298) DNA replication helicase/nuclease 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_125654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_166103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076881 MISSION® esiRNA esiRNA human DNA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080449 Rosetta Predictions human pricing
XM_166103 Rosetta Predictions human pricing
XM_241671 Rosetta Predictions rat pricing
NM_177372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314946 predicted 3116
2 SASI_Hs02_00314947 predicted 1879
3 SASI_Hs02_00314948 predicted 2824
4 SASI_Hs02_00314949 predicted 1916
5 SASI_Hs02_00314950 predicted 3407
6 SASI_Hs02_00314951 predicted 1644
7 SASI_Hs02_00314952 predicted 1782
8 SASI_Hs02_00314953 predicted 1550
9 SASI_Hs02_00314954 predicted 1005
10 SASI_Hs02_00314955 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299362 predicted 3127
2 SASI_Hs01_00299363 predicted 1886
3 SASI_Hs01_00299364 predicted 2823
4 SASI_Hs01_00299365 predicted 1610
5 SASI_Hs01_00299366 predicted 3140
6 SASI_Hs01_00299367 predicted 1355
7 SASI_Hs01_00299368 predicted 1651
8 SASI_Hs01_00299369 predicted 1790
9 SASI_Hs01_00299370 predicted 1451
10 SASI_Hs01_00299371 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_241671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391649 predicted 704
2 SASI_Rn02_00391650 predicted 1391
3 SASI_Rn02_00391651 predicted 393
4 SASI_Rn02_00391652 predicted 752
5 SASI_Rn02_00391653 predicted 715
6 SASI_Rn02_00391654 predicted 598
7 SASI_Rn02_00391655 predicted 613
8 SASI_Rn02_00391656 predicted 1315
9 SASI_Rn02_00391657 predicted 838
10 SASI_Rn02_00391658 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056767 predicted 327
2 SASI_Mm01_00056768 predicted 2922
3 SASI_Mm01_00056769 predicted 1700
4 SASI_Mm01_00056770 predicted 570
5 SASI_Mm01_00056771 predicted 1565
6 SASI_Mm01_00056772 predicted 401
7 SASI_Mm01_00056773 predicted 2112
8 SASI_Mm02_00347531 predicted 3209
9 SASI_Mm01_00056774 predicted 2892
10 SASI_Mm01_00056775 predicted 1748
11 SASI_Mm01_00056776 predicted 1514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125654
DNA2 MISSION shRNA Bacterial Glycerol Stock
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125654.5-3742s1c1
Sequence:CCGGCGGGTCTGATTCCCAAATCATCTCGAGATGATTTGGGAATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-652s1c1
Sequence:CCGGCAGATGCTGATCGGTACAATTCTCGAGAATTGTACCGATCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2939s1c1
Sequence:CCGGCCAGACTCATTGTCTTCCTAACTCGAGTTAGGAAGACAATGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2245s1c1
Sequence:CCGGCTCCTGAAGTTAGCCAAGTTTCTCGAGAAACTTGGCTAACTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2369s1c1
Sequence:CCGGCCCATCTAGAAGAACTCTATACTCGAGTATAGAGTTCTTCTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125654
DNA2 MISSION shRNA shRNA Plasmid DNA
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125654.5-3742s1c1
Sequence:CCGGCGGGTCTGATTCCCAAATCATCTCGAGATGATTTGGGAATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-652s1c1
Sequence:CCGGCAGATGCTGATCGGTACAATTCTCGAGAATTGTACCGATCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2939s1c1
Sequence:CCGGCCAGACTCATTGTCTTCCTAACTCGAGTTAGGAAGACAATGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2245s1c1
Sequence:CCGGCTCCTGAAGTTAGCCAAGTTTCTCGAGAAACTTGGCTAACTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2369s1c1
Sequence:CCGGCCCATCTAGAAGAACTCTATACTCGAGTATAGAGTTCTTCTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125654
DNA2 MISSION shRNA Lentiviral Transduction Particles
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125654.5-3742s1c1
Sequence:CCGGCGGGTCTGATTCCCAAATCATCTCGAGATGATTTGGGAATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-652s1c1
Sequence:CCGGCAGATGCTGATCGGTACAATTCTCGAGAATTGTACCGATCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2939s1c1
Sequence:CCGGCCAGACTCATTGTCTTCCTAACTCGAGTTAGGAAGACAATGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2245s1c1
Sequence:CCGGCTCCTGAAGTTAGCCAAGTTTCTCGAGAAACTTGGCTAACTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125654.5-2369s1c1
Sequence:CCGGCCCATCTAGAAGAACTCTATACTCGAGTATAGAGTTCTTCTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166103
VALIDATED
DNA2 MISSION shRNA Bacterial Glycerol Stock
DNA replication helicase/nuclease 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-3483s1c1
Sequence:CCGGCCAGCTTTGAAGATGGATTAACTCGAGTTAATCCATCTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.4-2979s1c1
Sequence:CCGGCGAAGTTAATACAGTAGACAACTCGAGTTGTCTACTGTATTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-1897s1c1
Sequence:CCGGCCTCAGTTTATATCCTACCTTCTCGAGAAGGTAGGATATAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-2896s1c1
Sequence:CCGGCCCTCTGATATTGGTATTATTCTCGAGAATAATACCAATATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.x-1073s1c1
Sequence:CCGGCAAGAGAGAAGAGCTGATCCACTCGAGTGGATCAGCTCTTCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.x-2573s1c1
Sequence:CCGGCAGTTAACCGTGCAGTACAGACTCGAGTCTGTACTGCACGGTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166103
VALIDATED
DNA2 MISSION shRNA shRNA Plasmid DNA
DNA replication helicase/nuclease 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-3483s1c1
Sequence:CCGGCCAGCTTTGAAGATGGATTAACTCGAGTTAATCCATCTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.4-2979s1c1
Sequence:CCGGCGAAGTTAATACAGTAGACAACTCGAGTTGTCTACTGTATTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-1897s1c1
Sequence:CCGGCCTCAGTTTATATCCTACCTTCTCGAGAAGGTAGGATATAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-2896s1c1
Sequence:CCGGCCCTCTGATATTGGTATTATTCTCGAGAATAATACCAATATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.x-1073s1c1
Sequence:CCGGCAAGAGAGAAGAGCTGATCCACTCGAGTGGATCAGCTCTTCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.x-2573s1c1
Sequence:CCGGCAGTTAACCGTGCAGTACAGACTCGAGTCTGTACTGCACGGTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166103
VALIDATED
DNA2 MISSION shRNA Lentiviral Transduction Particles
DNA replication helicase/nuclease 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-3483s1c1
Sequence:CCGGCCAGCTTTGAAGATGGATTAACTCGAGTTAATCCATCTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.4-2979s1c1
Sequence:CCGGCGAAGTTAATACAGTAGACAACTCGAGTTGTCTACTGTATTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-1897s1c1
Sequence:CCGGCCTCAGTTTATATCCTACCTTCTCGAGAAGGTAGGATATAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.4-2896s1c1
Sequence:CCGGCCCTCTGATATTGGTATTATTCTCGAGAATAATACCAATATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166103.x-1073s1c1
Sequence:CCGGCAAGAGAGAAGAGCTGATCCACTCGAGTGGATCAGCTCTTCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_166103.x-2573s1c1
Sequence:CCGGCAGTTAACCGTGCAGTACAGACTCGAGTCTGTACTGCACGGTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080449
DNA2 MISSION shRNA Bacterial Glycerol Stock
DNA replication helicase/nuclease 2
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000432076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-398s21c1
Sequence:CCGGACCTGGTGTTGGCAGTCAATACTCGAGTATTGACTGCCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-1728s21c1
Sequence:CCGGAGTTTGTGATGGGCAATATTTCTCGAGAAATATTGCCCATCACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080449
DNA2 MISSION shRNA shRNA Plasmid DNA
DNA replication helicase/nuclease 2
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000432076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-398s21c1
Sequence:CCGGACCTGGTGTTGGCAGTCAATACTCGAGTATTGACTGCCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-1728s21c1
Sequence:CCGGAGTTTGTGATGGGCAATATTTCTCGAGAAATATTGCCCATCACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080449
DNA2 MISSION shRNA Lentiviral Transduction Particles
DNA replication helicase/nuclease 2
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000432076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-398s21c1
Sequence:CCGGACCTGGTGTTGGCAGTCAATACTCGAGTATTGACTGCCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080449.1-1728s21c1
Sequence:CCGGAGTTTGTGATGGGCAATATTTCTCGAGAAATATTGCCCATCACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177372
VALIDATED
DNA2 MISSION shRNA Bacterial Glycerol Stock
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1580s21c1
Sequence:CCGGATGGCAGGTGACAGGATTATTCTCGAGAATAATCCTGTCACCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1388s21c1
Sequence:CCGGACGCTGGAGTCGCAATCTAAACTCGAGTTTAGATTGCGACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-2201s21c1
Sequence:CCGGTCGAGGTCCATTGCGTCTTTACTCGAGTAAAGACGCAATGGACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-1816s21c1
Sequence:CCGGTCGAGAATTAATCATCGATTTCTCGAGAAATCGATGATTAATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-3681s21c1
Sequence:CCGGGGGAGATCAGAGGACTATTACCTCGAGGTAATAGTCCTCTGATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177372
VALIDATED
DNA2 MISSION shRNA shRNA Plasmid DNA
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1580s21c1
Sequence:CCGGATGGCAGGTGACAGGATTATTCTCGAGAATAATCCTGTCACCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1388s21c1
Sequence:CCGGACGCTGGAGTCGCAATCTAAACTCGAGTTTAGATTGCGACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-2201s21c1
Sequence:CCGGTCGAGGTCCATTGCGTCTTTACTCGAGTAAAGACGCAATGGACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-1816s21c1
Sequence:CCGGTCGAGAATTAATCATCGATTTCTCGAGAAATCGATGATTAATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-3681s21c1
Sequence:CCGGGGGAGATCAGAGGACTATTACCTCGAGGTAATAGTCCTCTGATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177372
VALIDATED
DNA2 MISSION shRNA Lentiviral Transduction Particles
DNA replication helicase/nuclease 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1580s21c1
Sequence:CCGGATGGCAGGTGACAGGATTATTCTCGAGAATAATCCTGTCACCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-1388s21c1
Sequence:CCGGACGCTGGAGTCGCAATCTAAACTCGAGTTTAGATTGCGACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-2201s21c1
Sequence:CCGGTCGAGGTCCATTGCGTCTTTACTCGAGTAAAGACGCAATGGACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177372.2-1816s21c1
Sequence:CCGGTCGAGAATTAATCATCGATTTCTCGAGAAATCGATGATTAATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177372.2-3681s21c1
Sequence:CCGGGGGAGATCAGAGGACTATTACCTCGAGGTAATAGTCCTCTGATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks