EMAIL THIS PAGE TO A FRIEND

DNAAF1

dynein, axonemal, assembly factor 1

44 Gene Product Result for
Synonyms: CILD13 LRRC50 ODA7
Gene ID:
Human(123872) Summary: The protein encoded by this gene is cilium-specific and is required for the stability of the ciliary architecture. It is involved in the regulation of microtubule-based cilia and actin-based brush border microvilli. Mutations in this gene are associated with primary ciliary dyskinesia-13.[provided by RefSeq, May 2010]
Mouse(68270) dynein, axonemal assembly factor 1
Rat(361419) dynein, axonemal, assembly factor 1
naked mole-rat(101711622) dynein, axonemal, assembly factor 1
domestic guinea pig(100730131) dynein, axonemal, assembly factor 1
sheep(101102412) dynein, axonemal, assembly factor 1
Zebrafish(386722) dynein, axonemal, assembly factor 1
chicken(415702) dynein, axonemal, assembly factor 1
dog(479628) dynein, axonemal, assembly factor 1
domestic cat(101087891) dynein, axonemal, assembly factor 1
cow(523187) dynein, axonemal, assembly factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041166 Anti-DNAAF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV53359 Anti-LRRC50 antibody produced in rabbit affinity isolated antibody bovine, mouse, guinea pig, human, horse, canine, rat,
western blot pricing
SAB2101390 Anti-LRRC50 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, canine, rat, human, mouse, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026531 MISSION® esiRNA esiRNA targeting mouse Lrrc50 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178452 Rosetta Predictions human pricing
NM_001014154 Rosetta Predictions rat pricing
NM_026648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066027 predicted 360
2 SASI_Hs01_00066028 predicted 508
3 SASI_Hs01_00066029 predicted 945
4 SASI_Hs01_00066030 predicted 501
5 SASI_Hs01_00066032 predicted 492
6 SASI_Hs01_00066033 predicted 654
7 SASI_Hs01_00066034 predicted 584
8 SASI_Hs02_00369681 predicted 534
9 SASI_Hs01_00066035 predicted 1778
10 SASI_Hs01_00066036 predicted 626
11 SASI_Hs01_00066031 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097659 predicted 854
2 SASI_Rn01_00097661 predicted 1805
3 SASI_Rn01_00097662 predicted 1670
4 SASI_Rn02_00201638 predicted 1593
5 SASI_Rn01_00097663 predicted 252
6 SASI_Rn01_00097664 predicted 1429
7 SASI_Rn02_00201639 predicted 1663
8 SASI_Rn01_00097665 predicted 623
9 SASI_Rn01_00097667 predicted 815
10 SASI_Rn01_00097668 predicted 1942
11 SASI_Rn01_00097660 predicted 396
12 SASI_Rn01_00097666 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021954 predicted 1561
2 SASI_Mm01_00021955 predicted 1997
3 SASI_Mm01_00021956 predicted 1744
4 SASI_Mm01_00021957 predicted 915
5 SASI_Mm01_00021958 predicted 1544
6 SASI_Mm01_00021959 predicted 2035
7 SASI_Mm01_00021960 predicted 218
8 SASI_Mm01_00021961 predicted 885
9 SASI_Mm01_00021962 predicted 2008
10 SASI_Mm01_00021963 predicted 1489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178452
DNAAF1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-501s21c1
Sequence:CCGGCATTGAATGATACGCTGTATTCTCGAGAATACAGCGTATCATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1451s21c1
Sequence:CCGGTCGTCACCTGTGGAGGTTAAACTCGAGTTTAACCTCCACAGGTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-979s21c1
Sequence:CCGGGACAGTCACTGTACGACTAAACTCGAGTTTAGTCGTACAGTGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1607s21c1
Sequence:CCGGTCACCGCCTGTGAAGGTTAAACTCGAGTTTAACCTTCACAGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-796s1c1
Sequence:CCGGCCTTGACCTTTCGCACAACAACTCGAGTTGTTGTGCGAAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-482s1c1
Sequence:CCGGGATCGCATTGAGAACCTGGAACTCGAGTTCCAGGTTCTCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-443s1c1
Sequence:CCGGGCATTGAATGATACGCTGTATCTCGAGATACAGCGTATCATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178452.3-1819s1c1
Sequence:CCGGCCAGAATATGTGCTTTCCGAACTCGAGTTCGGAAAGCACATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-598s1c1
Sequence:CCGGGCAAATGAACTTGCTCCGTAACTCGAGTTACGGAGCAAGTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-532s1c1
Sequence:CCGGGCAGAGCAATGGAATACAGAACTCGAGTTCTGTATTCCATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178452
DNAAF1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-501s21c1
Sequence:CCGGCATTGAATGATACGCTGTATTCTCGAGAATACAGCGTATCATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1451s21c1
Sequence:CCGGTCGTCACCTGTGGAGGTTAAACTCGAGTTTAACCTCCACAGGTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-979s21c1
Sequence:CCGGGACAGTCACTGTACGACTAAACTCGAGTTTAGTCGTACAGTGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1607s21c1
Sequence:CCGGTCACCGCCTGTGAAGGTTAAACTCGAGTTTAACCTTCACAGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-796s1c1
Sequence:CCGGCCTTGACCTTTCGCACAACAACTCGAGTTGTTGTGCGAAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-482s1c1
Sequence:CCGGGATCGCATTGAGAACCTGGAACTCGAGTTCCAGGTTCTCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-443s1c1
Sequence:CCGGGCATTGAATGATACGCTGTATCTCGAGATACAGCGTATCATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178452.3-1819s1c1
Sequence:CCGGCCAGAATATGTGCTTTCCGAACTCGAGTTCGGAAAGCACATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-598s1c1
Sequence:CCGGGCAAATGAACTTGCTCCGTAACTCGAGTTACGGAGCAAGTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-532s1c1
Sequence:CCGGGCAGAGCAATGGAATACAGAACTCGAGTTCTGTATTCCATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178452
DNAAF1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-501s21c1
Sequence:CCGGCATTGAATGATACGCTGTATTCTCGAGAATACAGCGTATCATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1451s21c1
Sequence:CCGGTCGTCACCTGTGGAGGTTAAACTCGAGTTTAACCTCCACAGGTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-979s21c1
Sequence:CCGGGACAGTCACTGTACGACTAAACTCGAGTTTAGTCGTACAGTGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178452.4-1607s21c1
Sequence:CCGGTCACCGCCTGTGAAGGTTAAACTCGAGTTTAACCTTCACAGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-796s1c1
Sequence:CCGGCCTTGACCTTTCGCACAACAACTCGAGTTGTTGTGCGAAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-482s1c1
Sequence:CCGGGATCGCATTGAGAACCTGGAACTCGAGTTCCAGGTTCTCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-443s1c1
Sequence:CCGGGCATTGAATGATACGCTGTATCTCGAGATACAGCGTATCATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178452.3-1819s1c1
Sequence:CCGGCCAGAATATGTGCTTTCCGAACTCGAGTTCGGAAAGCACATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-598s1c1
Sequence:CCGGGCAAATGAACTTGCTCCGTAACTCGAGTTACGGAGCAAGTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178452.3-532s1c1
Sequence:CCGGGCAGAGCAATGGAATACAGAACTCGAGTTCTGTATTCCATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026648
DNAAF1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026648.1-2190s1c1
Sequence:CCGGCCACAAGAACATAAACACTTTCTCGAGAAAGTGTTTATGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-430s1c1
Sequence:CCGGCCTGAACGACACCCTGTATTTCTCGAGAAATACAGGGTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-592s1c1
Sequence:CCGGCCTGTTGCACAAGATCGAGAACTCGAGTTCTCGATCTTGTGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-437s1c1
Sequence:CCGGGACACCCTGTATTTGCACTTTCTCGAGAAAGTGCAAATACAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-1729s1c1
Sequence:CCGGGCCAATAGCAACAACGGACTTCTCGAGAAGTCCGTTGTTGCTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026648
DNAAF1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026648.1-2190s1c1
Sequence:CCGGCCACAAGAACATAAACACTTTCTCGAGAAAGTGTTTATGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-430s1c1
Sequence:CCGGCCTGAACGACACCCTGTATTTCTCGAGAAATACAGGGTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-592s1c1
Sequence:CCGGCCTGTTGCACAAGATCGAGAACTCGAGTTCTCGATCTTGTGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-437s1c1
Sequence:CCGGGACACCCTGTATTTGCACTTTCTCGAGAAAGTGCAAATACAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-1729s1c1
Sequence:CCGGGCCAATAGCAACAACGGACTTCTCGAGAAGTCCGTTGTTGCTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026648
DNAAF1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026648.1-2190s1c1
Sequence:CCGGCCACAAGAACATAAACACTTTCTCGAGAAAGTGTTTATGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-430s1c1
Sequence:CCGGCCTGAACGACACCCTGTATTTCTCGAGAAATACAGGGTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-592s1c1
Sequence:CCGGCCTGTTGCACAAGATCGAGAACTCGAGTTCTCGATCTTGTGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-437s1c1
Sequence:CCGGGACACCCTGTATTTGCACTTTCTCGAGAAAGTGCAAATACAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026648.1-1729s1c1
Sequence:CCGGGCCAATAGCAACAACGGACTTCTCGAGAAGTCCGTTGTTGCTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks