EMAIL THIS PAGE TO A FRIEND

DNAAF2

dynein, axonemal, assembly factor 2

69 Gene Product Result for
Synonyms: C14orf104 CILD10 KTU PF13
UniProtKB ID: Q9NVR5, B9WS54, C0JAP7, Q86TR1, Q86TY8, Q969Z5
Gene ID:
Human(55172) Summary: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in this gene have been associated with primary ciliary dyskinesia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(109065) dynein, axonemal assembly factor 2
Rat(362746) dynein, axonemal, assembly factor 2
Zebrafish(606664) dynein, axonemal, assembly factor 2
chicken(423566) dynein, axonemal, assembly factor 2
dog(480313) dynein, axonemal, assembly factor 2
cow(534465) dynein, axonemal, assembly factor 2
domestic cat(101092369) dynein, axonemal, assembly factor 2
sheep(101122790) dynein, axonemal, assembly factor 2
domestic guinea pig(100724856) dynein, axonemal, assembly factor 2
naked mole-rat(101704134) dynein, axonemal, assembly factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083908 Rosetta Predictions human pricing
NM_018139 Rosetta Predictions human pricing
NM_001014197 Rosetta Predictions rat pricing
NM_027269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317261 predicted 2280
2 SASI_Hs02_00317262 predicted 2207
3 SASI_Hs02_00317263 predicted 2155
4 SASI_Hs02_00317264 predicted 211
5 SASI_Hs02_00317265 predicted 2215
6 SASI_Hs02_00317266 predicted 1525
7 SASI_Hs02_00317267 predicted 1670
8 SASI_Hs02_00317268 predicted 1632
9 SASI_Hs02_00317269 predicted 2239
10 SASI_Hs02_00317270 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161055 predicted 2428
2 SASI_Hs02_00351360 predicted 2351
3 SASI_Hs02_00351361 predicted 2302
4 SASI_Hs02_00351362 predicted 215
5 SASI_Hs01_00161062 predicted 2359
6 SASI_Hs02_00351363 predicted 1525
7 SASI_Hs02_00351364 predicted 1671
8 SASI_Hs02_00351365 predicted 1635
9 SASI_Hs02_00351366 predicted 2379
10 SASI_Hs02_00351367 predicted 1714
11 SASI_Hs01_00161056 predicted 589
12 SASI_Hs01_00161057 predicted 463
13 SASI_Hs01_00161058 predicted 1028
14 SASI_Hs01_00161059 predicted 987
15 SASI_Hs01_00161060 predicted 1066
16 SASI_Hs01_00161061 predicted 1019
17 SASI_Hs01_00161063 predicted 928
18 SASI_Hs01_00161064 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081195 predicted 750
2 SASI_Rn01_00081196 predicted 556
3 SASI_Rn01_00081197 predicted 390
4 SASI_Rn01_00081199 predicted 802
5 SASI_Rn02_00201717 predicted 295
6 SASI_Rn01_00081200 predicted 450
7 SASI_Rn01_00081202 predicted 254
8 SASI_Rn01_00081203 predicted 642
9 SASI_Rn01_00081204 predicted 810
10 SASI_Rn02_00201718 predicted 335
11 SASI_Rn01_00081198 predicted 314
12 SASI_Rn01_00081201 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046235 predicted 1900
2 SASI_Mm01_00046236 predicted 1885
3 SASI_Mm02_00331846 predicted 1933
4 SASI_Mm01_00046237 predicted 1772
5 SASI_Mm01_00046238 predicted 2345
6 SASI_Mm01_00046239 predicted 230
7 SASI_Mm02_00331847 predicted 1889
8 SASI_Mm01_00046242 predicted 1641
9 SASI_Mm02_00331848 predicted 2078
10 SASI_Mm02_00331849 predicted 1915
11 SASI_Mm01_00046234 predicted 1940
12 SASI_Mm01_00046240 predicted 1751
13 SASI_Mm01_00046241 predicted 1681
14 SASI_Mm01_00046243 predicted 1706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027269
VALIDATED
DNAAF2 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.2-732s1c1
Sequence:CCGGGAGTTGCAGGAATGTAGTGATCTCGAGATCACTACATTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1679s1c1
Sequence:CCGGCTGAGATTAAAGGCCAAAGTACTCGAGTACTTTGGCCTTTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1678s1c1
Sequence:CCGGGCTGAGATTAAAGGCCAAAGTCTCGAGACTTTGGCCTTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1760s21c1
Sequence:CCGGCTACACAAGACTCGGGTTATTCTCGAGAATAACCCGAGTCTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2469s21c1
Sequence:CCGGACCTGACTTTGACACTATAAACTCGAGTTTATAGTGTCAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.3-2422s1c1
Sequence:CCGGGGAGATCACCCATCTTCATTACTCGAGTAATGAAGATGGGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1893s21c1
Sequence:CCGGACTTTGGCGAGAGTGGTATTGCTCGAGCAATACCACTCTCGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1663s21c1
Sequence:CCGGGACGAAGACTCCTTGACTTTGCTCGAGCAAAGTCAAGGAGTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2381s21c1
Sequence:CCGGATATAAGAGAGCCAGTAATAACTCGAGTTATTACTGGCTCTCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027269
VALIDATED
DNAAF2 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.2-732s1c1
Sequence:CCGGGAGTTGCAGGAATGTAGTGATCTCGAGATCACTACATTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1679s1c1
Sequence:CCGGCTGAGATTAAAGGCCAAAGTACTCGAGTACTTTGGCCTTTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1678s1c1
Sequence:CCGGGCTGAGATTAAAGGCCAAAGTCTCGAGACTTTGGCCTTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1760s21c1
Sequence:CCGGCTACACAAGACTCGGGTTATTCTCGAGAATAACCCGAGTCTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2469s21c1
Sequence:CCGGACCTGACTTTGACACTATAAACTCGAGTTTATAGTGTCAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.3-2422s1c1
Sequence:CCGGGGAGATCACCCATCTTCATTACTCGAGTAATGAAGATGGGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1893s21c1
Sequence:CCGGACTTTGGCGAGAGTGGTATTGCTCGAGCAATACCACTCTCGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1663s21c1
Sequence:CCGGGACGAAGACTCCTTGACTTTGCTCGAGCAAAGTCAAGGAGTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2381s21c1
Sequence:CCGGATATAAGAGAGCCAGTAATAACTCGAGTTATTACTGGCTCTCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027269
VALIDATED
DNAAF2 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.2-732s1c1
Sequence:CCGGGAGTTGCAGGAATGTAGTGATCTCGAGATCACTACATTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1679s1c1
Sequence:CCGGCTGAGATTAAAGGCCAAAGTACTCGAGTACTTTGGCCTTTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027269.2-1678s1c1
Sequence:CCGGGCTGAGATTAAAGGCCAAAGTCTCGAGACTTTGGCCTTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1760s21c1
Sequence:CCGGCTACACAAGACTCGGGTTATTCTCGAGAATAACCCGAGTCTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2469s21c1
Sequence:CCGGACCTGACTTTGACACTATAAACTCGAGTTTATAGTGTCAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027269.3-2422s1c1
Sequence:CCGGGGAGATCACCCATCTTCATTACTCGAGTAATGAAGATGGGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1893s21c1
Sequence:CCGGACTTTGGCGAGAGTGGTATTGCTCGAGCAATACCACTCTCGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-1663s21c1
Sequence:CCGGGACGAAGACTCCTTGACTTTGCTCGAGCAAAGTCAAGGAGTCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027269.3-2381s21c1
Sequence:CCGGATATAAGAGAGCCAGTAATAACTCGAGTTATTACTGGCTCTCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018139
VALIDATED
DNAAF2 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-685s1c1
Sequence:CCGGGACATTGGAGAGAGTGGTATTCTCGAGAATACCACTCTCTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1284s1c1
Sequence:CCGGGAAACCAATATGCAGGATGGTCTCGAGACCATCCTGCATATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-444s1c1
Sequence:CCGGCTGTGTAATCAGGACAAAGAACTCGAGTTCTTTGTCCTGATTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-440s1c1
Sequence:CCGGGTTACTGTGTAATCAGGACAACTCGAGTTGTCCTGATTACACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-1308s1c1
Sequence:CCGGGTGCAGGTCATTAAAGATCATCTCGAGATGATCTTTAATGACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1181s1c1
Sequence:CCGGCGAGTCAGTAATAACTGAAGACTCGAGTCTTCAGTTATTACTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-978s1c1
Sequence:CCGGCCTACAACTGATTCTGATTCACTCGAGTGAATCAGAATCAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-553s1c1
Sequence:CCGGCCGCACAAGACTTAGTTTATTCTCGAGAATAAACTAAGTCTTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-878s1c1
Sequence:CCGGGCAAGAATGTAGTAACTCTGACTCGAGTCAGAGTTACTACATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1146s1c1
Sequence:CCGGGCTACTTGTTCAAATGAGGAACTCGAGTTCCTCATTTGAACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-502s1c1
Sequence:CCGGCGCAAAGTCTTCAAGGAGATTCTCGAGAATCTCCTTGAAGACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018139
VALIDATED
DNAAF2 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-685s1c1
Sequence:CCGGGACATTGGAGAGAGTGGTATTCTCGAGAATACCACTCTCTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1284s1c1
Sequence:CCGGGAAACCAATATGCAGGATGGTCTCGAGACCATCCTGCATATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-444s1c1
Sequence:CCGGCTGTGTAATCAGGACAAAGAACTCGAGTTCTTTGTCCTGATTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-440s1c1
Sequence:CCGGGTTACTGTGTAATCAGGACAACTCGAGTTGTCCTGATTACACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-1308s1c1
Sequence:CCGGGTGCAGGTCATTAAAGATCATCTCGAGATGATCTTTAATGACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1181s1c1
Sequence:CCGGCGAGTCAGTAATAACTGAAGACTCGAGTCTTCAGTTATTACTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-978s1c1
Sequence:CCGGCCTACAACTGATTCTGATTCACTCGAGTGAATCAGAATCAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-553s1c1
Sequence:CCGGCCGCACAAGACTTAGTTTATTCTCGAGAATAAACTAAGTCTTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-878s1c1
Sequence:CCGGGCAAGAATGTAGTAACTCTGACTCGAGTCAGAGTTACTACATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1146s1c1
Sequence:CCGGGCTACTTGTTCAAATGAGGAACTCGAGTTCCTCATTTGAACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-502s1c1
Sequence:CCGGCGCAAAGTCTTCAAGGAGATTCTCGAGAATCTCCTTGAAGACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018139
VALIDATED
DNAAF2 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-685s1c1
Sequence:CCGGGACATTGGAGAGAGTGGTATTCTCGAGAATACCACTCTCTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1284s1c1
Sequence:CCGGGAAACCAATATGCAGGATGGTCTCGAGACCATCCTGCATATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-444s1c1
Sequence:CCGGCTGTGTAATCAGGACAAAGAACTCGAGTTCTTTGTCCTGATTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018139.1-440s1c1
Sequence:CCGGGTTACTGTGTAATCAGGACAACTCGAGTTGTCCTGATTACACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-1308s1c1
Sequence:CCGGGTGCAGGTCATTAAAGATCATCTCGAGATGATCTTTAATGACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1181s1c1
Sequence:CCGGCGAGTCAGTAATAACTGAAGACTCGAGTCTTCAGTTATTACTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-978s1c1
Sequence:CCGGCCTACAACTGATTCTGATTCACTCGAGTGAATCAGAATCAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-553s1c1
Sequence:CCGGCCGCACAAGACTTAGTTTATTCTCGAGAATAAACTAAGTCTTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018139.1-878s1c1
Sequence:CCGGGCAAGAATGTAGTAACTCTGACTCGAGTCAGAGTTACTACATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-1146s1c1
Sequence:CCGGGCTACTTGTTCAAATGAGGAACTCGAGTTCCTCATTTGAACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018139.1-502s1c1
Sequence:CCGGCGCAAAGTCTTCAAGGAGATTCTCGAGAATCTCCTTGAAGACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks