EMAIL THIS PAGE TO A FRIEND

DNAAF3

dynein, axonemal, assembly factor 3

47 Gene Product Result for
Synonyms: C19orf51 CILD2 DAB1 PCD PF22
UniProtKB ID: Q8N9W5, A8MUY0, E9PAX5, Q6P4F6, Q8N9W0, Q96AR2
Gene ID:
Human(352909) Summary: The protein encoded by this gene is required for the assembly of axonemal inner and outer dynein arms and plays a role in assembling dynein complexes for transport into cilia. Defects in this gene are a cause of primary ciliary dyskinesia type 2 (CILD2). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(436022) dynein, axonemal assembly factor 3
Rat(100359753) dynein, axonemal, assembly factor 3
naked mole-rat(101711890) dynein, axonemal, assembly factor 3
domestic guinea pig(100714373) dynein, axonemal, assembly factor 3
Zebrafish(100885771) dynein, axonemal, assembly factor 3
cow(789814) dynein, axonemal, assembly factor 3
domestic cat(101092564) dynein, axonemal, assembly factor 3
dog(484300) dynein, axonemal, assembly factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178837 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031802 Rosetta Predictions human pricing
NM_178837 Rosetta Predictions human pricing
NM_001033548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227599 predicted 450
2 SASI_Hs01_00227600 predicted 425
3 SASI_Hs01_00227601 predicted 260
4 SASI_Hs01_00227602 predicted 112
5 SASI_Hs01_00227603 predicted 925
6 SASI_Hs01_00227604 predicted 377
7 SASI_Hs01_00227605 predicted 259
8 SASI_Hs01_00227606 predicted 549
9 SASI_Hs01_00227607 predicted 398
10 SASI_Hs01_00227608 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107500 predicted 1215
2 SASI_Hs01_00107501 predicted 1203
3 SASI_Hs01_00107502 predicted 1286
4 SASI_Hs02_00369888 predicted 246
5 SASI_Hs01_00107503 predicted 1275
6 SASI_Hs01_00107505 predicted 1522
7 SASI_Hs01_00107506 predicted 1808
8 SASI_Hs02_00369889 predicted 842
9 SASI_Hs01_00107507 predicted 1301
10 SASI_Hs01_00107508 predicted 1485
11 SASI_Hs01_00107504 predicted 1278
12 SASI_Hs01_00107509 predicted 1948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288923 predicted 1301
2 SASI_Mm01_00076153 predicted 1140
3 SASI_Mm02_00288924 predicted 1650
4 SASI_Mm01_00076154 predicted 811
5 SASI_Mm01_00076155 predicted 457
6 SASI_Mm01_00076156 predicted 1252
7 SASI_Mm01_00076157 predicted 1371
8 SASI_Mm01_00076158 predicted 527
9 SASI_Mm01_00076159 predicted 1189
10 SASI_Mm01_00076160 predicted 981
11 SASI_Mm01_00076152 predicted 810
12 SASI_Mm01_00076161 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033548
DNAAF3 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-946s21c1
Sequence:CCGGAGCCTCTTACGGACGAGAAACCTCGAGGTTTCTCGTCCGTAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-278s21c1
Sequence:CCGGGGCCTCTCAGGAGCTTCAATTCTCGAGAATTGAAGCTCCTGAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033548.2-1839s21c1
Sequence:CCGGGACCACGTAGCCCACCTTTAACTCGAGTTAAAGGTGGGCTACGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1497s21c1
Sequence:CCGGCCCTCTCCCAGAATCGATAAGCTCGAGCTTATCGATTCTGGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1400s21c1
Sequence:CCGGTTGCGAGGTTCTACAAGTTAGCTCGAGCTAACTTGTAGAACCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033548
DNAAF3 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-946s21c1
Sequence:CCGGAGCCTCTTACGGACGAGAAACCTCGAGGTTTCTCGTCCGTAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-278s21c1
Sequence:CCGGGGCCTCTCAGGAGCTTCAATTCTCGAGAATTGAAGCTCCTGAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033548.2-1839s21c1
Sequence:CCGGGACCACGTAGCCCACCTTTAACTCGAGTTAAAGGTGGGCTACGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1497s21c1
Sequence:CCGGCCCTCTCCCAGAATCGATAAGCTCGAGCTTATCGATTCTGGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1400s21c1
Sequence:CCGGTTGCGAGGTTCTACAAGTTAGCTCGAGCTAACTTGTAGAACCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033548
DNAAF3 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-946s21c1
Sequence:CCGGAGCCTCTTACGGACGAGAAACCTCGAGGTTTCTCGTCCGTAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-278s21c1
Sequence:CCGGGGCCTCTCAGGAGCTTCAATTCTCGAGAATTGAAGCTCCTGAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033548.2-1839s21c1
Sequence:CCGGGACCACGTAGCCCACCTTTAACTCGAGTTAAAGGTGGGCTACGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1497s21c1
Sequence:CCGGCCCTCTCCCAGAATCGATAAGCTCGAGCTTATCGATTCTGGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033548.2-1400s21c1
Sequence:CCGGTTGCGAGGTTCTACAAGTTAGCTCGAGCTAACTTGTAGAACCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178837
VALIDATED
DNAAF3 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, assembly factor 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178837.3-107s21c1
Sequence:CCGGCCGGGATATTTGGAGGATAAACTCGAGTTTATCCTCCAAATATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1356s21c1
Sequence:CCGGGGGAACTTGATTGTGGAATTACTCGAGTAATTCCACAATCAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1440s21c1
Sequence:CCGGCTAGCTCAGGCAGCTGGATTTCTCGAGAAATCCAGCTGCCTGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1219s21c1
Sequence:CCGGTCCACTTCCTGCCGCTCAATTCTCGAGAATTGAGCGGCAGGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1817s21c1
Sequence:CCGGAGGATGAGAACCCGCTGATACCTCGAGGTATCAGCGGGTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178837
VALIDATED
DNAAF3 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, assembly factor 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178837.3-107s21c1
Sequence:CCGGCCGGGATATTTGGAGGATAAACTCGAGTTTATCCTCCAAATATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1356s21c1
Sequence:CCGGGGGAACTTGATTGTGGAATTACTCGAGTAATTCCACAATCAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1440s21c1
Sequence:CCGGCTAGCTCAGGCAGCTGGATTTCTCGAGAAATCCAGCTGCCTGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1219s21c1
Sequence:CCGGTCCACTTCCTGCCGCTCAATTCTCGAGAATTGAGCGGCAGGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1817s21c1
Sequence:CCGGAGGATGAGAACCCGCTGATACCTCGAGGTATCAGCGGGTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178837
VALIDATED
DNAAF3 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, assembly factor 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178837.3-107s21c1
Sequence:CCGGCCGGGATATTTGGAGGATAAACTCGAGTTTATCCTCCAAATATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1356s21c1
Sequence:CCGGGGGAACTTGATTGTGGAATTACTCGAGTAATTCCACAATCAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1440s21c1
Sequence:CCGGCTAGCTCAGGCAGCTGGATTTCTCGAGAAATCCAGCTGCCTGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1219s21c1
Sequence:CCGGTCCACTTCCTGCCGCTCAATTCTCGAGAATTGAGCGGCAGGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178837.3-1817s21c1
Sequence:CCGGAGGATGAGAACCCGCTGATACCTCGAGGTATCAGCGGGTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks