EMAIL THIS PAGE TO A FRIEND

DNAH10

dynein, axonemal, heavy chain 10

96 Gene Product Result for
UniProtKB ID: Q8IVF4, C9JMF5, O95495, Q6ZUC9, Q6ZUP6, Q8N761
Gene ID:
Human(196385) Summary: Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]
Mouse(56087) dynein, axonemal, heavy chain 10
Rat(117252) dynein, axonemal, heavy chain 10
naked mole-rat(101699306) dynein, axonemal, heavy chain 10
domestic guinea pig(100733849) dynein, axonemal, heavy chain 10
sheep(101121295) dynein, axonemal, heavy chain 10
chicken(416818) dynein, axonemal, heavy chain 10
dog(486244) dynein, axonemal, heavy chain 10
Horse(100061177) dynein, axonemal, heavy chain 10
cow(100847550) dynein, axonemal, heavy chain 10
domestic cat(101084743) dynein, axonemal, heavy chain 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0389 AQUA Peptide ICQDLS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083900 Rosetta Predictions human pricing
NM_207437 Rosetta Predictions human pricing
XM_001071882 Rosetta Predictions rat pricing
XM_001078937 Rosetta Predictions rat pricing
XM_001474159 Rosetta Predictions mouse pricing
XM_915600 Rosetta Predictions mouse pricing
XM_978566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317241 predicted 1776
2 SASI_Hs02_00317242 predicted 981
3 SASI_Hs02_00317243 predicted 1863
4 SASI_Hs02_00317244 predicted 2385
5 SASI_Hs02_00317245 predicted 1026
6 SASI_Hs02_00317246 predicted 1151
7 SASI_Hs02_00317247 predicted 1733
8 SASI_Hs02_00317248 predicted 2964
9 SASI_Hs02_00317249 predicted 2776
10 SASI_Hs02_00317250 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216224 predicted 1294
2 SASI_Hs02_00374079 predicted 498
3 SASI_Hs01_00216226 predicted 1375
4 SASI_Hs02_00374080 predicted 1893
5 SASI_Hs01_00216230 predicted 535
6 SASI_Hs01_00216231 predicted 664
7 SASI_Hs01_00216232 predicted 1239
8 SASI_Hs02_00374081 predicted 2480
9 SASI_Hs02_00374082 predicted 2283
10 SASI_Hs02_00374083 predicted 655
11 SASI_Hs01_00216225 predicted 1774
12 SASI_Hs01_00216227 predicted 405
13 SASI_Hs01_00216228 predicted 2806
14 SASI_Hs01_00216229 predicted 2838
15 SASI_Hs01_00216233 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336856 predicted 5609
2 SASI_Rn02_00336857 predicted 5175
3 SASI_Rn02_00336858 predicted 813
4 SASI_Rn02_00336859 predicted 4495
5 SASI_Rn02_00336860 predicted 5880
6 SASI_Rn02_00336861 predicted 4482
7 SASI_Rn02_00336862 predicted 1737
8 SASI_Rn02_00336863 predicted 6032
9 SASI_Rn02_00336864 predicted 436
10 SASI_Rn02_00336865 predicted 7394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362560 predicted 8196
2 SASI_Rn02_00362561 predicted 5510
3 SASI_Rn02_00362562 predicted 5167
4 SASI_Rn02_00362563 predicted 811
5 SASI_Rn02_00362564 predicted 4494
6 SASI_Rn02_00362565 predicted 5786
7 SASI_Rn02_00362566 predicted 4483
8 SASI_Rn02_00362567 predicted 7610
9 SASI_Rn02_00362568 predicted 440
10 SASI_Rn02_00362569 predicted 7402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00373421 predicted 6379
2 SASI_Mm02_00373422 predicted 5304
3 SASI_Mm02_00373423 predicted 2293
4 SASI_Mm02_00373424 predicted 2528
5 SASI_Mm02_00373425 predicted 10085
6 SASI_Mm02_00373426 predicted 1653
7 SASI_Mm02_00373427 predicted 5816
8 SASI_Mm02_00373428 predicted 10764
9 SASI_Mm02_00373429 predicted 9885
10 SASI_Mm02_00373430 predicted 10362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439609 predicted 6296
2 SASI_Mm02_00439610 predicted 5217
3 SASI_Mm02_00439611 predicted 2210
4 SASI_Mm02_00439612 predicted 2447
5 SASI_Mm02_00439613 predicted 10003
6 SASI_Mm02_00439614 predicted 1572
7 SASI_Mm02_00439615 predicted 5732
8 SASI_Mm02_00439616 predicted 10683
9 SASI_Mm02_00439617 predicted 9806
10 SASI_Mm02_00439618 predicted 10283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278523 predicted 5577
2 SASI_Mm01_00278524 predicted 4512
3 SASI_Mm01_00278525 predicted 1504
4 SASI_Mm01_00278526 predicted 1733
5 SASI_Mm01_00278527 predicted 9366
6 SASI_Mm01_00278528 predicted 1028
7 SASI_Mm01_00278529 predicted 5018
8 SASI_Mm01_00278530 predicted 10017
9 SASI_Mm01_00278531 predicted 9159
10 SASI_Mm01_00278532 predicted 9620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207438
DNAH10 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 10
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207438.1-346s1c1
Sequence:CCGGCTGAGGTTTAATGACGGCGATCTCGAGATCGCCGTCATTAAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1901s1c1
Sequence:CCGGCCGTCGTCATTAACACTCTGTCTCGAGACAGAGTGTTAATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1527s1c1
Sequence:CCGGGCTGTCCAAGCAGTATCACTACTCGAGTAGTGATACTGCTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1834s1c1
Sequence:CCGGCAAATGTTCGAGACCATGTTACTCGAGTAACATGGTCTCGAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-785s1c1
Sequence:CCGGCCAGAGACATAGTTGATTCTTCTCGAGAAGAATCAACTATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2817s1c1
Sequence:CCGGCGAGAGGAAATTCATCAACATCTCGAGATGTTGATGAATTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2731s1c1
Sequence:CCGGCCAACCTTGTATGACTTTCATCTCGAGATGAAAGTCATACAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2533s1c1
Sequence:CCGGGCGTTGCTAGAAGGAGAAATACTCGAGTATTTCTCCTTCTAGCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-784s1c1
Sequence:CCGGGCCAGAGACATAGTTGATTCTCTCGAGAGAATCAACTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-403s1c1
Sequence:CCGGGAAGGAGAAGTCATGGAGTTTCTCGAGAAACTCCATGACTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-259s1c1
Sequence:CCGGGACGATGAGTTGCTTAGCATTCTCGAGAATGCTAAGCAACTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2413s1c1
Sequence:CCGGCCCTATCTCATGGATGTGATACTCGAGTATCACATCCATGAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207438
DNAH10 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 10
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207438.1-346s1c1
Sequence:CCGGCTGAGGTTTAATGACGGCGATCTCGAGATCGCCGTCATTAAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1901s1c1
Sequence:CCGGCCGTCGTCATTAACACTCTGTCTCGAGACAGAGTGTTAATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1527s1c1
Sequence:CCGGGCTGTCCAAGCAGTATCACTACTCGAGTAGTGATACTGCTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1834s1c1
Sequence:CCGGCAAATGTTCGAGACCATGTTACTCGAGTAACATGGTCTCGAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-785s1c1
Sequence:CCGGCCAGAGACATAGTTGATTCTTCTCGAGAAGAATCAACTATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2817s1c1
Sequence:CCGGCGAGAGGAAATTCATCAACATCTCGAGATGTTGATGAATTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2731s1c1
Sequence:CCGGCCAACCTTGTATGACTTTCATCTCGAGATGAAAGTCATACAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2533s1c1
Sequence:CCGGGCGTTGCTAGAAGGAGAAATACTCGAGTATTTCTCCTTCTAGCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-784s1c1
Sequence:CCGGGCCAGAGACATAGTTGATTCTCTCGAGAGAATCAACTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-403s1c1
Sequence:CCGGGAAGGAGAAGTCATGGAGTTTCTCGAGAAACTCCATGACTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-259s1c1
Sequence:CCGGGACGATGAGTTGCTTAGCATTCTCGAGAATGCTAAGCAACTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2413s1c1
Sequence:CCGGCCCTATCTCATGGATGTGATACTCGAGTATCACATCCATGAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207438
DNAH10 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 10
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207438.1-346s1c1
Sequence:CCGGCTGAGGTTTAATGACGGCGATCTCGAGATCGCCGTCATTAAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1901s1c1
Sequence:CCGGCCGTCGTCATTAACACTCTGTCTCGAGACAGAGTGTTAATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1527s1c1
Sequence:CCGGGCTGTCCAAGCAGTATCACTACTCGAGTAGTGATACTGCTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-1834s1c1
Sequence:CCGGCAAATGTTCGAGACCATGTTACTCGAGTAACATGGTCTCGAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-785s1c1
Sequence:CCGGCCAGAGACATAGTTGATTCTTCTCGAGAAGAATCAACTATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2817s1c1
Sequence:CCGGCGAGAGGAAATTCATCAACATCTCGAGATGTTGATGAATTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2731s1c1
Sequence:CCGGCCAACCTTGTATGACTTTCATCTCGAGATGAAAGTCATACAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2533s1c1
Sequence:CCGGGCGTTGCTAGAAGGAGAAATACTCGAGTATTTCTCCTTCTAGCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-784s1c1
Sequence:CCGGGCCAGAGACATAGTTGATTCTCTCGAGAGAATCAACTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-403s1c1
Sequence:CCGGGAAGGAGAAGTCATGGAGTTTCTCGAGAAACTCCATGACTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207438.1-259s1c1
Sequence:CCGGGACGATGAGTTGCTTAGCATTCTCGAGAATGCTAAGCAACTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207438.1-2413s1c1
Sequence:CCGGCCCTATCTCATGGATGTGATACTCGAGTATCACATCCATGAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019536
DNAH10 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-7854s21c1
Sequence:CCGGTGAACGAGGAGACCAATATTGCTCGAGCAATATTGGTCTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-10984s21c1
Sequence:CCGGGGTTGACTATGACTCGAATTTCTCGAGAAATTCGAGTCATAGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-12736s21c1
Sequence:CCGGGCGCATCCTCACCACGTATATCTCGAGATATACGTGGTGAGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-3875s21c1
Sequence:CCGGACGGAGCAAGAACTGGTTAATCTCGAGATTAACCAGTTCTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-1380s21c1
Sequence:CCGGTGCGCATGGTGTGGATCATTTCTCGAGAAATGATCCACACCATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019536
DNAH10 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-7854s21c1
Sequence:CCGGTGAACGAGGAGACCAATATTGCTCGAGCAATATTGGTCTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-10984s21c1
Sequence:CCGGGGTTGACTATGACTCGAATTTCTCGAGAAATTCGAGTCATAGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-12736s21c1
Sequence:CCGGGCGCATCCTCACCACGTATATCTCGAGATATACGTGGTGAGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-3875s21c1
Sequence:CCGGACGGAGCAAGAACTGGTTAATCTCGAGATTAACCAGTTCTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-1380s21c1
Sequence:CCGGTGCGCATGGTGTGGATCATTTCTCGAGAAATGATCCACACCATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019536
DNAH10 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-7854s21c1
Sequence:CCGGTGAACGAGGAGACCAATATTGCTCGAGCAATATTGGTCTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-10984s21c1
Sequence:CCGGGGTTGACTATGACTCGAATTTCTCGAGAAATTCGAGTCATAGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-12736s21c1
Sequence:CCGGGCGCATCCTCACCACGTATATCTCGAGATATACGTGGTGAGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-3875s21c1
Sequence:CCGGACGGAGCAAGAACTGGTTAATCTCGAGATTAACCAGTTCTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019536.1-1380s21c1
Sequence:CCGGTGCGCATGGTGTGGATCATTTCTCGAGAAATGATCCACACCATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks