EMAIL THIS PAGE TO A FRIEND

DNAH11

dynein, axonemal, heavy chain 11

61 Gene Product Result for
Synonyms: CILD7 DNAHBL DNAHC11 DNHBL DPL11
UniProtKB ID: Q96DT5, Q9UJ82
Gene ID:
Human(8701) Summary: This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
Mouse(13411) dynein, axonemal, heavy chain 11
Rat(117253) dynein, axonemal, heavy chain 11
cow(497208) dynein, axonemal, heavy chain 11
Horse(100067501) dynein, axonemal, heavy chain 11
domestic cat(101094997) dynein, axonemal, heavy chain 11
dog(482346) dynein, axonemal, heavy chain 11
sheep(101120490) dynein, axonemal, heavy chain 11
domestic guinea pig(100733692) dynein, axonemal, heavy chain 11
naked mole-rat(101701195) dynein, axonemal, heavy chain 11
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124281 MISSION® esiRNA esiRNA human DNAH11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003777 Rosetta Predictions human pricing
XM_001061747 Rosetta Predictions rat pricing
XM_234720 Rosetta Predictions rat pricing
NM_010060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055332 predicted 13321
2 SASI_Hs02_00336273 predicted 8854
3 SASI_Hs02_00336274 predicted 11922
4 SASI_Hs01_00055335 predicted 4476
5 SASI_Hs01_00055336 predicted 12493
6 SASI_Hs01_00055337 predicted 12417
7 SASI_Hs01_00055338 predicted 5629
8 SASI_Hs02_00336275 predicted 7793
9 SASI_Hs02_00336276 predicted 722
10 SASI_Hs02_00336277 predicted 7938
11 SASI_Hs01_00055333 predicted 712
12 SASI_Hs01_00055334 predicted 11793
13 SASI_Hs01_00055339 predicted 3402
14 SASI_Hs01_00055340 predicted 3254
15 SASI_Hs01_00055341 predicted 2790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301224 predicted 10505
2 SASI_Rn02_00301225 predicted 2129
3 SASI_Rn02_00301226 predicted 12967
4 SASI_Rn02_00301227 predicted 12606
5 SASI_Rn02_00301228 predicted 2398
6 SASI_Rn02_00301229 predicted 899
7 SASI_Rn02_00301230 predicted 13210
8 SASI_Rn02_00301231 predicted 5162
9 SASI_Rn02_00301232 predicted 9728
10 SASI_Rn02_00301233 predicted 13059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388627 predicted 10527
2 SASI_Rn02_00388628 predicted 2126
3 SASI_Rn02_00388629 predicted 12988
4 SASI_Rn02_00388630 predicted 12622
5 SASI_Rn02_00388631 predicted 2399
6 SASI_Rn02_00388632 predicted 900
7 SASI_Rn02_00388633 predicted 13229
8 SASI_Rn02_00388634 predicted 13712
9 SASI_Rn02_00388635 predicted 5167
10 SASI_Rn02_00388636 predicted 9746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061546 predicted 5919
2 SASI_Mm01_00061547 predicted 11941
3 SASI_Mm01_00061548 predicted 7249
4 SASI_Mm01_00061549 predicted 2381
5 SASI_Mm01_00061551 predicted 5223
6 SASI_Mm01_00061552 predicted 5417
7 SASI_Mm01_00061554 predicted 13011
8 SASI_Mm02_00317718 predicted 3138
9 SASI_Mm02_00317719 predicted 8950
10 SASI_Mm02_00317720 predicted 7314
11 SASI_Mm01_00061550 predicted 9150
12 SASI_Mm01_00061553 predicted 6109
13 SASI_Mm01_00061555 predicted 5130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003777
DNAH11 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-3384s21c1
Sequence:CCGGTGAGCTTGTTAACCATAATTACTCGAGTAATTATGGTTAACAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-6818s21c1
Sequence:CCGGATAGTCCTGGATGGCGATATTCTCGAGAATATCGCCATCCAGGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-4860s1c1
Sequence:CCGGCCAGGCTTTCTCTTTGTGAAACTCGAGTTTCACAAAGAGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-12087s1c1
Sequence:CCGGGCCACAGAGATTACAGGGTTTCTCGAGAAACCCTGTAATCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-7302s1c1
Sequence:CCGGCCCTGCTACAAGATCAGATTTCTCGAGAAATCTGATCTTGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-728s1c1
Sequence:CCGGCCGTCAAATGAAAGGATAATACTCGAGTATTATCCTTTCATTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-10820s1c1
Sequence:CCGGCCTCACTATAAGCCGGAATTACTCGAGTAATTCCGGCTTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003777
DNAH11 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-3384s21c1
Sequence:CCGGTGAGCTTGTTAACCATAATTACTCGAGTAATTATGGTTAACAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-6818s21c1
Sequence:CCGGATAGTCCTGGATGGCGATATTCTCGAGAATATCGCCATCCAGGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-4860s1c1
Sequence:CCGGCCAGGCTTTCTCTTTGTGAAACTCGAGTTTCACAAAGAGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-12087s1c1
Sequence:CCGGGCCACAGAGATTACAGGGTTTCTCGAGAAACCCTGTAATCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-7302s1c1
Sequence:CCGGCCCTGCTACAAGATCAGATTTCTCGAGAAATCTGATCTTGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-728s1c1
Sequence:CCGGCCGTCAAATGAAAGGATAATACTCGAGTATTATCCTTTCATTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-10820s1c1
Sequence:CCGGCCTCACTATAAGCCGGAATTACTCGAGTAATTCCGGCTTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003777
DNAH11 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-3384s21c1
Sequence:CCGGTGAGCTTGTTAACCATAATTACTCGAGTAATTATGGTTAACAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003777.3-6818s21c1
Sequence:CCGGATAGTCCTGGATGGCGATATTCTCGAGAATATCGCCATCCAGGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-4860s1c1
Sequence:CCGGCCAGGCTTTCTCTTTGTGAAACTCGAGTTTCACAAAGAGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-12087s1c1
Sequence:CCGGGCCACAGAGATTACAGGGTTTCTCGAGAAACCCTGTAATCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-7302s1c1
Sequence:CCGGCCCTGCTACAAGATCAGATTTCTCGAGAAATCTGATCTTGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-728s1c1
Sequence:CCGGCCGTCAAATGAAAGGATAATACTCGAGTATTATCCTTTCATTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003777.1-10820s1c1
Sequence:CCGGCCTCACTATAAGCCGGAATTACTCGAGTAATTCCGGCTTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010060
DNAH11 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-5137s21c1
Sequence:CCGGGGATCTGCAGTTCGAAGATAACTCGAGTTATCTTCGAACTGCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-9887s21c1
Sequence:CCGGGCGTTAATTAACTACGATAAACTCGAGTTTATCGTAGTTAATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-11390s21c1
Sequence:CCGAGAGCGCATCTGTGCCCTAATACTCGAGTATTAGGGCACAGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-4935s1c1
Sequence:CCGGCCCACCTCTATGAGAAACTTACTCGAGTAAGTTTCTCATAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-9338s1c1
Sequence:CCGGCCCAGGAGTTTCTTAGAACAACTCGAGTTGTTCTAAGAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010060.1-13789s1c1
Sequence:CCGGGCGAGTAATCACAGTACACAACTCGAGTTGTGTACTGTGATTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-2014s1c1
Sequence:CCGGCGGGCATGAAATTCTGAACAACTCGAGTTGTTCAGAATTTCATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-608s1c1
Sequence:CCGGCCCAGGTCATTGCTTACACATCTCGAGATGTGTAAGCAATGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010060
DNAH11 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-5137s21c1
Sequence:CCGGGGATCTGCAGTTCGAAGATAACTCGAGTTATCTTCGAACTGCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-9887s21c1
Sequence:CCGGGCGTTAATTAACTACGATAAACTCGAGTTTATCGTAGTTAATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-11390s21c1
Sequence:CCGAGAGCGCATCTGTGCCCTAATACTCGAGTATTAGGGCACAGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-4935s1c1
Sequence:CCGGCCCACCTCTATGAGAAACTTACTCGAGTAAGTTTCTCATAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-9338s1c1
Sequence:CCGGCCCAGGAGTTTCTTAGAACAACTCGAGTTGTTCTAAGAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010060.1-13789s1c1
Sequence:CCGGGCGAGTAATCACAGTACACAACTCGAGTTGTGTACTGTGATTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-2014s1c1
Sequence:CCGGCGGGCATGAAATTCTGAACAACTCGAGTTGTTCAGAATTTCATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-608s1c1
Sequence:CCGGCCCAGGTCATTGCTTACACATCTCGAGATGTGTAAGCAATGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010060
DNAH11 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-5137s21c1
Sequence:CCGGGGATCTGCAGTTCGAAGATAACTCGAGTTATCTTCGAACTGCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-9887s21c1
Sequence:CCGGGCGTTAATTAACTACGATAAACTCGAGTTTATCGTAGTTAATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010060.2-11390s21c1
Sequence:CCGAGAGCGCATCTGTGCCCTAATACTCGAGTATTAGGGCACAGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-4935s1c1
Sequence:CCGGCCCACCTCTATGAGAAACTTACTCGAGTAAGTTTCTCATAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-9338s1c1
Sequence:CCGGCCCAGGAGTTTCTTAGAACAACTCGAGTTGTTCTAAGAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010060.1-13789s1c1
Sequence:CCGGGCGAGTAATCACAGTACACAACTCGAGTTGTGTACTGTGATTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-2014s1c1
Sequence:CCGGCGGGCATGAAATTCTGAACAACTCGAGTTGTTCAGAATTTCATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010060.1-608s1c1
Sequence:CCGGCCCAGGTCATTGCTTACACATCTCGAGATGTGTAAGCAATGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks