EMAIL THIS PAGE TO A FRIEND

DNAH12

dynein, axonemal, heavy chain 12

57 Gene Product Result for
Synonyms: DHC3 DLP12 DNAH12L DNAH7L DNAHC12 DNAHC3 DNHD2 HDHC3 HL-19 HL19
UniProtKB ID: Q6ZR08, A6NGI2, Q6ZTR8, Q8N7R9, Q8WXK2, Q92816
Gene ID:
Mouse(110083) dynein, axonemal, heavy chain 12
Rat(252959) dynein, axonemal, heavy chain 12
naked mole-rat(101710660) dynein, axonemal, heavy chain 12
sheep(101108960) dynein, axonemal, heavy chain 12
Zebrafish(799461) dynein, axonemal, heavy chain 12
chicken(416004) dynein, axonemal, heavy chain 12
domestic cat(101080950) dynein, axonemal, heavy chain 12
dog(484715) dynein heavy chain 12, axonemal-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178504 Rosetta Predictions human pricing
XM_001057601 Rosetta Predictions rat pricing
XM_341392 Rosetta Predictions rat pricing
XM_976110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191734 predicted 2659
2 SASI_Hs01_00191735 predicted 2281
3 SASI_Hs01_00191736 predicted 2492
4 SASI_Hs01_00191737 predicted 1048
5 SASI_Hs01_00191738 predicted 1076
6 SASI_Hs01_00191739 predicted 3153
7 SASI_Hs01_00191740 predicted 3268
8 SASI_Hs01_00191741 predicted 441
9 SASI_Hs01_00191742 predicted 2768
10 SASI_Hs01_00191743 predicted 2858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286918 predicted 4795
2 SASI_Rn02_00286919 predicted 753
3 SASI_Rn02_00286920 predicted 11197
4 SASI_Rn02_00286921 predicted 4773
5 SASI_Rn02_00286922 predicted 10301
6 SASI_Rn02_00286923 predicted 5174
7 SASI_Rn02_00286924 predicted 737
8 SASI_Rn02_00286925 predicted 690
9 SASI_Rn02_00286926 predicted 6250
10 SASI_Rn02_00286927 predicted 7939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392838 predicted 4788
2 SASI_Rn02_00392839 predicted 5633
3 SASI_Rn02_00392840 predicted 750
4 SASI_Rn02_00392841 predicted 4778
5 SASI_Rn02_00392842 predicted 5173
6 SASI_Rn02_00392843 predicted 733
7 SASI_Rn02_00392844 predicted 692
8 SASI_Rn02_00392845 predicted 6252
9 SASI_Rn02_00392846 predicted 7937
10 SASI_Rn02_00392847 predicted 4923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233887 predicted 2159
2 SASI_Mm01_00233888 predicted 8935
3 SASI_Mm01_00233889 predicted 2139
4 SASI_Mm02_00445888 predicted 6588
5 SASI_Mm01_00233890 predicted 4347
6 SASI_Mm01_00233891 predicted 5055
7 SASI_Mm01_00233892 predicted 6246
8 SASI_Mm01_00233893 predicted 8920
9 SASI_Mm01_00233894 predicted 5084
10 SASI_Mm01_00233895 predicted 3580
11 SASI_Mm01_00233896 predicted 3134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178504
DNAH12 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2898s1c1
Sequence:CCGGCCGGTAGCTTACTTGTTGGAACTCGAGTTCCAACAAGTAAGCTACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-2537s1c1
Sequence:CCGGCCTGAGATATTTGGATTACATCTCGAGATGTAATCCAAATATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1483s1c1
Sequence:CCGGGCGAGAAATCTATGACAGTAACTCGAGTTACTGTCATAGATTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-460s1c1
Sequence:CCGGGCTATCAGATTCAGACTATATCTCGAGATATAGTCTGAATCTGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1484s1c1
Sequence:CCGGCGAGAAATCTATGACAGTAAACTCGAGTTTACTGTCATAGATTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-1532s1c1
Sequence:CCGGCCAATGGATAAGAACCTAAATCTCGAGATTTAGGTTCTTATCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2707s1c1
Sequence:CCGGCCCTAGTGATTTCGACATTGACTCGAGTCAATGTCGAAATCACTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2096s1c1
Sequence:CCGGCCAGTTTCTGATCCTGAGTTTCTCGAGAAACTCAGGATCAGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178504
DNAH12 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2898s1c1
Sequence:CCGGCCGGTAGCTTACTTGTTGGAACTCGAGTTCCAACAAGTAAGCTACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-2537s1c1
Sequence:CCGGCCTGAGATATTTGGATTACATCTCGAGATGTAATCCAAATATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1483s1c1
Sequence:CCGGGCGAGAAATCTATGACAGTAACTCGAGTTACTGTCATAGATTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-460s1c1
Sequence:CCGGGCTATCAGATTCAGACTATATCTCGAGATATAGTCTGAATCTGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1484s1c1
Sequence:CCGGCGAGAAATCTATGACAGTAAACTCGAGTTTACTGTCATAGATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-1532s1c1
Sequence:CCGGCCAATGGATAAGAACCTAAATCTCGAGATTTAGGTTCTTATCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2707s1c1
Sequence:CCGGCCCTAGTGATTTCGACATTGACTCGAGTCAATGTCGAAATCACTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2096s1c1
Sequence:CCGGCCAGTTTCTGATCCTGAGTTTCTCGAGAAACTCAGGATCAGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178504
DNAH12 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2898s1c1
Sequence:CCGGCCGGTAGCTTACTTGTTGGAACTCGAGTTCCAACAAGTAAGCTACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-2537s1c1
Sequence:CCGGCCTGAGATATTTGGATTACATCTCGAGATGTAATCCAAATATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1483s1c1
Sequence:CCGGGCGAGAAATCTATGACAGTAACTCGAGTTACTGTCATAGATTTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-460s1c1
Sequence:CCGGGCTATCAGATTCAGACTATATCTCGAGATATAGTCTGAATCTGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178504.3-1484s1c1
Sequence:CCGGCGAGAAATCTATGACAGTAAACTCGAGTTTACTGTCATAGATTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-1532s1c1
Sequence:CCGGCCAATGGATAAGAACCTAAATCTCGAGATTTAGGTTCTTATCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2707s1c1
Sequence:CCGGCCCTAGTGATTTCGACATTGACTCGAGTCAATGTCGAAATCACTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178504.3-2096s1c1
Sequence:CCGGCCAGTTTCTGATCCTGAGTTTCTCGAGAAACTCAGGATCAGAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)