EMAIL THIS PAGE TO A FRIEND

DNAH14

dynein, axonemal, heavy chain 14

83 Gene Product Result for
Synonyms: C1orf67 Dnahc14 HL-18 HL18
Gene ID:
Human(127602) Summary: Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]
Mouse(240960) dynein, axonemal, heavy chain 14
chicken(421322) chromosome 1 open reading frame 67
Horse(100056953) dynein, axonemal, heavy chain 14
cow(516576) dynein, axonemal, heavy chain 14
domestic cat(101084763) dynein, axonemal, heavy chain 14
dog(480114) dynein, axonemal, heavy chain 14
sheep(101104330) dynein, axonemal, heavy chain 14
Domestic Rabbit(100351682) dynein, axonemal, heavy chain 14
domestic guinea pig(100719731) dynein, axonemal, heavy chain 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721899 Rosetta Predictions human pricing
XM_059166 Rosetta Predictions human pricing
XM_938194 Rosetta Predictions human pricing
NM_172846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445806 predicted 1357
2 SASI_Hs02_00445807 predicted 990
3 SASI_Hs02_00445808 predicted 2716
4 SASI_Hs02_00445809 predicted 1587
5 SASI_Hs02_00445810 predicted 2794
6 SASI_Hs02_00445811 predicted 930
7 SASI_Hs02_00445812 predicted 2755
8 SASI_Hs02_00445813 predicted 3015
9 SASI_Hs02_00445814 predicted 2728
10 SASI_Hs02_00445815 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478684 predicted 10695
2 SASI_Hs01_00280651 predicted 7837
3 SASI_Hs02_00478685 predicted 5726
4 SASI_Hs02_00478686 predicted 1270
5 SASI_Hs01_00280656 predicted 9084
6 SASI_Hs02_00478687 predicted 12354
7 SASI_Hs02_00478688 predicted 3685
8 SASI_Hs01_00280659 predicted 5303
9 SASI_Hs02_00478689 predicted 10914
10 SASI_Hs02_00478690 predicted 10185
11 SASI_Hs01_00280652 predicted 403
12 SASI_Hs01_00280653 predicted 3172
13 SASI_Hs01_00280654 predicted 6217
14 SASI_Hs01_00280655 predicted 4217
15 SASI_Hs01_00280657 predicted 2245
16 SASI_Hs01_00280658 predicted 3431
17 SASI_Hs01_00280660 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482972 predicted 10232
2 SASI_Hs02_00482973 predicted 7376
3 SASI_Hs02_00482974 predicted 5264
4 SASI_Hs02_00482975 predicted 808
5 SASI_Hs02_00482976 predicted 8617
6 SASI_Hs02_00482977 predicted 11883
7 SASI_Hs02_00482978 predicted 3220
8 SASI_Hs02_00482979 predicted 4833
9 SASI_Hs02_00482980 predicted 10450
10 SASI_Hs02_00482981 predicted 9721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127909 predicted 1621
2 SASI_Mm01_00127910 predicted 737
3 SASI_Mm01_00127911 predicted 1692
4 SASI_Mm01_00127913 predicted 999
5 SASI_Mm01_00127914 predicted 1070
6 SASI_Mm01_00127915 predicted 1606
7 SASI_Mm01_00127916 predicted 989
8 SASI_Mm01_00127917 predicted 742
9 SASI_Mm02_00344792 predicted 431
10 SASI_Mm02_00344793 predicted 325
11 SASI_Mm01_00127912 predicted 671
12 SASI_Mm01_00127918 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172846
DNAH14 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172846.1-1750s1c1
Sequence:CCGGGATTGTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-892s1c1
Sequence:CCGGGCCTTGAATAACTACCATGAACTCGAGTTCATGGTAGTTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-836s1c1
Sequence:CCGGCCAACAAGATTGCGATGGTTTCTCGAGAAACCATCGCAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-288s1c1
Sequence:CCGGGCAGACAAAGAGGAATCGCTTCTCGAGAAGCGATTCCTCTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-1612s1c1
Sequence:CCGGCCTGAAACATTCCCTCCCAATCTCGAGATTGGGAGGGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172846
DNAH14 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172846.1-1750s1c1
Sequence:CCGGGATTGTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-892s1c1
Sequence:CCGGGCCTTGAATAACTACCATGAACTCGAGTTCATGGTAGTTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-836s1c1
Sequence:CCGGCCAACAAGATTGCGATGGTTTCTCGAGAAACCATCGCAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-288s1c1
Sequence:CCGGGCAGACAAAGAGGAATCGCTTCTCGAGAAGCGATTCCTCTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-1612s1c1
Sequence:CCGGCCTGAAACATTCCCTCCCAATCTCGAGATTGGGAGGGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172846
DNAH14 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172846.1-1750s1c1
Sequence:CCGGGATTGTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-892s1c1
Sequence:CCGGGCCTTGAATAACTACCATGAACTCGAGTTCATGGTAGTTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-836s1c1
Sequence:CCGGCCAACAAGATTGCGATGGTTTCTCGAGAAACCATCGCAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-288s1c1
Sequence:CCGGGCAGACAAAGAGGAATCGCTTCTCGAGAAGCGATTCCTCTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172846.1-1612s1c1
Sequence:CCGGCCTGAAACATTCCCTCCCAATCTCGAGATTGGGAGGGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks