EMAIL THIS PAGE TO A FRIEND

DNAH17

dynein, axonemal, heavy chain 17

64 Gene Product Result for
Synonyms: DNAHL1 DNEL2
UniProtKB ID: Q9UFH2, O00431, O15206, Q2M2Y1, Q6ZRQ2, Q8N7Q7
Gene ID:
Human(8632) Summary: Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]
Mouse(69926) dynein, axonemal, heavy chain 17
Rat(287845) dynein, axonemal, heavy chain 17
domestic guinea pig(100725357) dynein, axonemal, heavy chain 17
naked mole-rat(101704510) dynein, axonemal, heavy chain 17
sheep(101113255) dynein, axonemal, heavy chain 17
chicken(768861) dynein, axonemal, heavy chain 17
dog(475921) dynein, axonemal, heavy chain 17
cow(788092) dynein, axonemal, heavy chain 17
domestic cat(101082357) dynein, axonemal, heavy chain 17
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0854 AQUA Peptide DLGEENF[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213621 MISSION® esiRNA esiRNA targeting mouse Dnahc17 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003727 Rosetta Predictions human pricing
NM_173628 Rosetta Predictions human pricing
NM_001105855 Rosetta Predictions rat pricing
XM_001481301 Rosetta Predictions mouse pricing
XM_126677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158714 predicted 922
2 SASI_Hs01_00158715 predicted 2927
3 SASI_Hs01_00158716 predicted 4494
4 SASI_Hs01_00158717 predicted 1331
5 SASI_Hs01_00158718 predicted 1764
6 SASI_Hs01_00158719 predicted 3259
7 SASI_Hs01_00158720 predicted 198
8 SASI_Hs01_00158721 predicted 3595
9 SASI_Hs01_00158722 predicted 2516
10 SASI_Hs01_00158723 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129536 predicted 1469
2 SASI_Hs01_00129537 predicted 844
3 SASI_Hs01_00129538 predicted 863
4 SASI_Hs01_00129539 predicted 486
5 SASI_Hs01_00129540 predicted 1390
6 SASI_Hs01_00129541 predicted 1498
7 SASI_Hs01_00129542 predicted 608
8 SASI_Hs01_00129543 predicted 1246
9 SASI_Hs01_00129544 predicted 1447
10 SASI_Hs01_00129545 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213192 predicted 12147
2 SASI_Rn02_00213193 predicted 13526
3 SASI_Rn02_00213194 predicted 10729
4 SASI_Rn02_00213195 predicted 10949
5 SASI_Rn02_00213196 predicted 10277
6 SASI_Rn02_00213197 predicted 11325
7 SASI_Rn02_00213198 predicted 10334
8 SASI_Rn02_00213199 predicted 11530
9 SASI_Rn02_00213200 predicted 13160
10 SASI_Rn02_00213201 predicted 12481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423534 predicted 8662
2 SASI_Mm02_00423535 predicted 2257
3 SASI_Mm02_00423536 predicted 12727
4 SASI_Mm02_00423537 predicted 6127
5 SASI_Mm02_00423538 predicted 6344
6 SASI_Mm02_00423539 predicted 9681
7 SASI_Mm02_00423540 predicted 7643
8 SASI_Mm02_00423541 predicted 11269
9 SASI_Mm02_00423542 predicted 8956
10 SASI_Mm02_00423543 predicted 10686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259957 predicted 719
2 SASI_Mm02_00424153 predicted 7884
3 SASI_Mm01_00259959 predicted 2252
4 SASI_Mm01_00259960 predicted 5676
5 SASI_Mm01_00259961 predicted 6128
6 SASI_Mm01_00259965 predicted 3326
7 SASI_Mm02_00424154 predicted 6343
8 SASI_Mm02_00424155 predicted 7638
9 SASI_Mm02_00424156 predicted 6265
10 SASI_Mm02_00424157 predicted 5544
11 SASI_Mm01_00259956 predicted 2259
12 SASI_Mm01_00259958 predicted 4924
13 SASI_Mm01_00259962 predicted 4179
14 SASI_Mm01_00259963 predicted 5360
15 SASI_Mm01_00259964 predicted 5640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003727
DNAH17 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-226s1c1
Sequence:CCGGCTACAACTACACCACACCCAACTCGAGTTGGGTGTGGTGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4640s1c1
Sequence:CCGGCCTGTGCACCTGTGACTTATTCTCGAGAATAAGTCACAGGTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-799s1c1
Sequence:CCGGGAAGTTCGACAAGGAGCACATCTCGAGATGTGCTCCTTGTCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-3823s1c1
Sequence:CCGGGACTTTCAACATGGCTGAGATCTCGAGATCTCAGCCATGTTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4643s1c1
Sequence:CCGGGTGCACCTGTGACTTATTCTTCTCGAGAAGAATAAGTCACAGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003727
DNAH17 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-226s1c1
Sequence:CCGGCTACAACTACACCACACCCAACTCGAGTTGGGTGTGGTGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4640s1c1
Sequence:CCGGCCTGTGCACCTGTGACTTATTCTCGAGAATAAGTCACAGGTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-799s1c1
Sequence:CCGGGAAGTTCGACAAGGAGCACATCTCGAGATGTGCTCCTTGTCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-3823s1c1
Sequence:CCGGGACTTTCAACATGGCTGAGATCTCGAGATCTCAGCCATGTTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4643s1c1
Sequence:CCGGGTGCACCTGTGACTTATTCTTCTCGAGAAGAATAAGTCACAGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003727
DNAH17 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-226s1c1
Sequence:CCGGCTACAACTACACCACACCCAACTCGAGTTGGGTGTGGTGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4640s1c1
Sequence:CCGGCCTGTGCACCTGTGACTTATTCTCGAGAATAAGTCACAGGTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-799s1c1
Sequence:CCGGGAAGTTCGACAAGGAGCACATCTCGAGATGTGCTCCTTGTCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003727.1-3823s1c1
Sequence:CCGGGACTTTCAACATGGCTGAGATCTCGAGATCTCAGCCATGTTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003727.1-4643s1c1
Sequence:CCGGGTGCACCTGTGACTTATTCTTCTCGAGAAGAATAAGTCACAGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173628
DNAH17 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-247s1c1
Sequence:CCGGCATCGAGATGACACGAACCTTCTCGAGAAGGTTCGTGTCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-587s1c1
Sequence:CCGGCGTATCTATGATGAGGTCTTTCTCGAGAAAGACCTCATCATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1621s1c1
Sequence:CCGGGCTGTTTGAAAGAAAGGACAACTCGAGTTGTCCTTTCTTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-1496s1c1
Sequence:CCGGGAAGGTGTGTTTCAGTACATTCTCGAGAATGTACTGAAACACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-226s1c1
Sequence:CCGGGCAGGAGTTCTGCAACCAAATCTCGAGATTTGGTTGCAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1525s1c1
Sequence:CCGGGCGAGAAATTCTGCACAACTTCTCGAGAAGTTGTGCAGAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-381s1c1
Sequence:CCGGGCTGCGTGAACATGAAGCTTTCTCGAGAAAGCTTCATGTTCACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173628
DNAH17 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-247s1c1
Sequence:CCGGCATCGAGATGACACGAACCTTCTCGAGAAGGTTCGTGTCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-587s1c1
Sequence:CCGGCGTATCTATGATGAGGTCTTTCTCGAGAAAGACCTCATCATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1621s1c1
Sequence:CCGGGCTGTTTGAAAGAAAGGACAACTCGAGTTGTCCTTTCTTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-1496s1c1
Sequence:CCGGGAAGGTGTGTTTCAGTACATTCTCGAGAATGTACTGAAACACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-226s1c1
Sequence:CCGGGCAGGAGTTCTGCAACCAAATCTCGAGATTTGGTTGCAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1525s1c1
Sequence:CCGGGCGAGAAATTCTGCACAACTTCTCGAGAAGTTGTGCAGAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-381s1c1
Sequence:CCGGGCTGCGTGAACATGAAGCTTTCTCGAGAAAGCTTCATGTTCACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173628
DNAH17 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-247s1c1
Sequence:CCGGCATCGAGATGACACGAACCTTCTCGAGAAGGTTCGTGTCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-587s1c1
Sequence:CCGGCGTATCTATGATGAGGTCTTTCTCGAGAAAGACCTCATCATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1621s1c1
Sequence:CCGGGCTGTTTGAAAGAAAGGACAACTCGAGTTGTCCTTTCTTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-1496s1c1
Sequence:CCGGGAAGGTGTGTTTCAGTACATTCTCGAGAATGTACTGAAACACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-226s1c1
Sequence:CCGGGCAGGAGTTCTGCAACCAAATCTCGAGATTTGGTTGCAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173628.1-1525s1c1
Sequence:CCGGGCGAGAAATTCTGCACAACTTCTCGAGAAGTTGTGCAGAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173628.1-381s1c1
Sequence:CCGGGCTGCGTGAACATGAAGCTTTCTCGAGAAAGCTTCATGTTCACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks