EMAIL THIS PAGE TO A FRIEND

DNAH1

dynein, axonemal, heavy chain 1

63 Gene Product Result for
Synonyms: DNAHC1 HDHC7 HL-11 HL11 XLHSRF-1
Gene ID:
Mouse(110084) dynein, axonemal, heavy chain 1
Rat(171339) dynein, axonemal, heavy chain 1
Zebrafish(100317899) dynein, axonemal, heavy chain 1
cow(540601) dynein, axonemal, heavy chain 1
Horse(100060282) dynein, axonemal, heavy chain 1
domestic cat(101082048) dynein, axonemal, heavy chain 1
dog(476598) dynein, axonemal, heavy chain 1
chicken(415943) dynein, axonemal, heavy chain 1
sheep(101112094) dynein, axonemal, heavy chain 1
Domestic Rabbit(100345761) dynein, axonemal, heavy chain 1
domestic guinea pig(100729323) dynein, axonemal, heavy chain 1
naked mole-rat(101722978) dynein, axonemal, heavy chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081561 MISSION® esiRNA esiRNA human DNAH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015512 Rosetta Predictions human pricing
NM_001033655 Rosetta Predictions rat pricing
XM_918655 Rosetta Predictions mouse pricing
XM_977593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347997 predicted 3670
2 SASI_Hs01_00145863 predicted 10159
3 SASI_Hs01_00145864 predicted 12851
4 SASI_Hs01_00145865 predicted 6014
5 SASI_Hs01_00145867 predicted 11835
6 SASI_Hs01_00145869 predicted 12273
7 SASI_Hs02_00347998 predicted 3713
8 SASI_Hs02_00347999 predicted 4540
9 SASI_Hs01_00145870 predicted 2569
10 SASI_Hs01_00145871 predicted 5743
11 SASI_Hs01_00145866 predicted 12313
12 SASI_Hs01_00145868 predicted 896
13 SASI_Hs01_00145872 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203654 predicted 6871
2 SASI_Rn01_00101981 predicted 9020
3 SASI_Rn01_00101982 predicted 7620
4 SASI_Rn02_00203655 predicted 1379
5 SASI_Rn01_00101983 predicted 9925
6 SASI_Rn01_00101984 predicted 10636
7 SASI_Rn01_00101985 predicted 12787
8 SASI_Rn02_00203656 predicted 2727
9 SASI_Rn01_00101987 predicted 6516
10 SASI_Rn01_00101988 predicted 12779
11 SASI_Rn01_00101986 predicted 5520
12 SASI_Rn01_00101989 predicted 8913
13 SASI_Rn01_00101990 predicted 9061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441936 predicted 6316
2 SASI_Mm02_00441937 predicted 6191
3 SASI_Mm02_00441938 predicted 6722
4 SASI_Mm02_00441939 predicted 4275
5 SASI_Mm02_00441940 predicted 10060
6 SASI_Mm02_00441941 predicted 6942
7 SASI_Mm02_00441942 predicted 7836
8 SASI_Mm02_00441943 predicted 10047
9 SASI_Mm02_00441944 predicted 5348
10 SASI_Mm02_00441945 predicted 6151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211597 predicted 369
2 SASI_Mm01_00211598 predicted 1175
3 SASI_Mm02_00446375 predicted 572
4 SASI_Mm01_00211600 predicted 327
5 SASI_Mm01_00211601 predicted 258
6 SASI_Mm01_00211602 predicted 701
7 SASI_Mm01_00211603 predicted 518
8 SASI_Mm01_00211604 predicted 469
9 SASI_Mm01_00211605 predicted 523
10 SASI_Mm01_00211606 predicted 288
11 SASI_Mm01_00211599 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015512
DNAH1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-9361s1c1
Sequence:CCGGCCGGGAATGCATTACCAAGAACTCGAGTTCTTGGTAATGCATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-5848s1c1
Sequence:CCGGCGGGATATTCTCCTCGTTCATCTCGAGATGAACGAGGAGAATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-11327s1c1
Sequence:CCGGGACCTCTACAAGTTTGCCGAACTCGAGTTCGGCAAACTTGTAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-806s1c1
Sequence:CCGGCCACTGAAGGTATTTGACAATCTCGAGATTGTCAAATACCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-6934s1c1
Sequence:CCGGGCGCAACTTTATCTTCTTCATCTCGAGATGAAGAAGATAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015512
DNAH1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-9361s1c1
Sequence:CCGGCCGGGAATGCATTACCAAGAACTCGAGTTCTTGGTAATGCATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-5848s1c1
Sequence:CCGGCGGGATATTCTCCTCGTTCATCTCGAGATGAACGAGGAGAATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-11327s1c1
Sequence:CCGGGACCTCTACAAGTTTGCCGAACTCGAGTTCGGCAAACTTGTAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-806s1c1
Sequence:CCGGCCACTGAAGGTATTTGACAATCTCGAGATTGTCAAATACCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-6934s1c1
Sequence:CCGGGCGCAACTTTATCTTCTTCATCTCGAGATGAAGAAGATAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015512
DNAH1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-9361s1c1
Sequence:CCGGCCGGGAATGCATTACCAAGAACTCGAGTTCTTGGTAATGCATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-5848s1c1
Sequence:CCGGCGGGATATTCTCCTCGTTCATCTCGAGATGAACGAGGAGAATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-11327s1c1
Sequence:CCGGGACCTCTACAAGTTTGCCGAACTCGAGTTCGGCAAACTTGTAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-806s1c1
Sequence:CCGGCCACTGAAGGTATTTGACAATCTCGAGATTGTCAAATACCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015512.3-6934s1c1
Sequence:CCGGGCGCAACTTTATCTTCTTCATCTCGAGATGAAGAAGATAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks