EMAIL THIS PAGE TO A FRIEND

DNAH2

dynein, axonemal, heavy chain 2

74 Gene Product Result for
Synonyms: DNAHC2 DNHD3
UniProtKB ID: Q9P225, A8K992, B5MDX5, O15434, Q6PIH3, Q6ZR42
Gene ID:
Human(146754) Summary: Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]
Mouse(327954) dynein, axonemal, heavy chain 2
Rat(303242) dynein, axonemal, heavy chain 2
domestic cat(101099759) dynein, axonemal, heavy chain 2
Horse(100146115) dynein, axonemal, heavy chain 2
cow(789044) dynein, axonemal, heavy chain 2
dog(489480) dynein, axonemal, heavy chain 2
sheep(101104254) dynein, axonemal, heavy chain 2
naked mole-rat(101703301) dynein, axonemal, heavy chain 2
domestic guinea pig(100733393) dynein, axonemal, heavy chain 2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020877 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020877 Rosetta Predictions human pricing
XM_001079413 Rosetta Predictions rat pricing
XM_220603 Rosetta Predictions rat pricing
NM_001081330 Rosetta Predictions mouse pricing
XM_894696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225845 predicted 10425
2 SASI_Hs02_00354175 predicted 4173
3 SASI_Hs02_00354176 predicted 4099
4 SASI_Hs01_00225847 predicted 11356
5 SASI_Hs01_00225848 predicted 9492
6 SASI_Hs01_00225849 predicted 9543
7 SASI_Hs01_00225850 predicted 840
8 SASI_Hs01_00225851 predicted 7059
9 SASI_Hs01_00225854 predicted 7552
10 SASI_Hs02_00354177 predicted 10378
11 SASI_Hs01_00225846 predicted 4088
12 SASI_Hs01_00225852 predicted 12142
13 SASI_Hs01_00225853 predicted 2830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364310 predicted 5186
2 SASI_Rn02_00364311 predicted 1537
3 SASI_Rn02_00364312 predicted 4403
4 SASI_Rn02_00364313 predicted 2725
5 SASI_Rn02_00364314 predicted 1737
6 SASI_Rn02_00364315 predicted 10356
7 SASI_Rn02_00364316 predicted 10898
8 SASI_Rn02_00364317 predicted 3836
9 SASI_Rn02_00364318 predicted 9198
10 SASI_Rn02_00364319 predicted 11963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379426 predicted 5179
2 SASI_Rn02_00379427 predicted 1535
3 SASI_Rn02_00379428 predicted 4400
4 SASI_Rn02_00379429 predicted 2725
5 SASI_Rn02_00379430 predicted 1743
6 SASI_Rn02_00379431 predicted 3830
7 SASI_Rn02_00379432 predicted 1098
8 SASI_Rn02_00379433 predicted 9198
9 SASI_Rn02_00379434 predicted 8093
10 SASI_Rn02_00379435 predicted 8935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297361 predicted 12240
2 SASI_Mm02_00297362 predicted 7784
3 SASI_Mm02_00297363 predicted 1316
4 SASI_Mm02_00297364 predicted 8759
5 SASI_Mm02_00297365 predicted 12408
6 SASI_Mm02_00297366 predicted 4642
7 SASI_Mm02_00297367 predicted 2069
8 SASI_Mm02_00297368 predicted 10595
9 SASI_Mm02_00297369 predicted 12204
10 SASI_Mm02_00297370 predicted 9172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214656 predicted 7786
2 SASI_Mm01_00214657 predicted 1329
3 SASI_Mm01_00214658 predicted 8765
4 SASI_Mm01_00214659 predicted 12416
5 SASI_Mm01_00214660 predicted 4647
6 SASI_Mm01_00214661 predicted 2077
7 SASI_Mm01_00214662 predicted 10596
8 SASI_Mm01_00214663 predicted 12201
9 SASI_Mm01_00214664 predicted 9174
10 SASI_Mm01_00214665 predicted 12475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020877
DNAH2 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-380s1c1
Sequence:CCGGGATGCCATTCTGGAACACTTTCTCGAGAAAGTGTTCCAGAATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-6026s1c1
Sequence:CCGGGCTCTCAATGAGAGATATGAACTCGAGTTCATATCTCTCATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-497s1c1
Sequence:CCGGCTTGTCTACTTCATTCGCCAACTCGAGTTGGCGAATGAAGTAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2097s1c1
Sequence:CCGGGCCCTATTCAAAGAGCGTATTCTCGAGAATACGCTCTTTGAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-2288s1c1
Sequence:CCGGCAAGAATTTCACTCCCATCTTCTCGAGAAGATGGGAGTGAAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2546s1c1
Sequence:CCGGGCTAGAACTATCCAAGGCTATCTCGAGATAGCCTTGGATAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-11056s1c1
Sequence:CCGGGCCACAAACTACTATTCAGTTCTCGAGAACTGAATAGTAGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-12593s1c1
Sequence:CCGGCCAGAGATACAACACACTGATCTCGAGATCAGTGTGTTGTATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-496s1c1
Sequence:CCGGGCTTGTCTACTTCATTCGCCACTCGAGTGGCGAATGAAGTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-1582s1c1
Sequence:CCGGGCCACAGATAACACGGAACTTCTCGAGAAGTTCCGTGTTATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020877.1-2783s1c1
Sequence:CCGGCTATCTGACTAAACCAGTGATCTCGAGATCACTGGTTTAGTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020877
DNAH2 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-380s1c1
Sequence:CCGGGATGCCATTCTGGAACACTTTCTCGAGAAAGTGTTCCAGAATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-6026s1c1
Sequence:CCGGGCTCTCAATGAGAGATATGAACTCGAGTTCATATCTCTCATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-497s1c1
Sequence:CCGGCTTGTCTACTTCATTCGCCAACTCGAGTTGGCGAATGAAGTAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2097s1c1
Sequence:CCGGGCCCTATTCAAAGAGCGTATTCTCGAGAATACGCTCTTTGAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-2288s1c1
Sequence:CCGGCAAGAATTTCACTCCCATCTTCTCGAGAAGATGGGAGTGAAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2546s1c1
Sequence:CCGGGCTAGAACTATCCAAGGCTATCTCGAGATAGCCTTGGATAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-11056s1c1
Sequence:CCGGGCCACAAACTACTATTCAGTTCTCGAGAACTGAATAGTAGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-12593s1c1
Sequence:CCGGCCAGAGATACAACACACTGATCTCGAGATCAGTGTGTTGTATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-496s1c1
Sequence:CCGGGCTTGTCTACTTCATTCGCCACTCGAGTGGCGAATGAAGTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-1582s1c1
Sequence:CCGGGCCACAGATAACACGGAACTTCTCGAGAAGTTCCGTGTTATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020877.1-2783s1c1
Sequence:CCGGCTATCTGACTAAACCAGTGATCTCGAGATCACTGGTTTAGTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020877
DNAH2 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-380s1c1
Sequence:CCGGGATGCCATTCTGGAACACTTTCTCGAGAAAGTGTTCCAGAATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-6026s1c1
Sequence:CCGGGCTCTCAATGAGAGATATGAACTCGAGTTCATATCTCTCATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.1-497s1c1
Sequence:CCGGCTTGTCTACTTCATTCGCCAACTCGAGTTGGCGAATGAAGTAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2097s1c1
Sequence:CCGGGCCCTATTCAAAGAGCGTATTCTCGAGAATACGCTCTTTGAATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-2288s1c1
Sequence:CCGGCAAGAATTTCACTCCCATCTTCTCGAGAAGATGGGAGTGAAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-2546s1c1
Sequence:CCGGGCTAGAACTATCCAAGGCTATCTCGAGATAGCCTTGGATAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-11056s1c1
Sequence:CCGGGCCACAAACTACTATTCAGTTCTCGAGAACTGAATAGTAGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020877.2-12593s1c1
Sequence:CCGGCCAGAGATACAACACACTGATCTCGAGATCAGTGTGTTGTATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-496s1c1
Sequence:CCGGGCTTGTCTACTTCATTCGCCACTCGAGTGGCGAATGAAGTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020877.1-1582s1c1
Sequence:CCGGGCCACAGATAACACGGAACTTCTCGAGAAGTTCCGTGTTATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020877.1-2783s1c1
Sequence:CCGGCTATCTGACTAAACCAGTGATCTCGAGATCACTGGTTTAGTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks