EMAIL THIS PAGE TO A FRIEND

DNAH3

dynein, axonemal, heavy chain 3

70 Gene Product Result for
Synonyms: DLP3 DNAHC3B Hsadhc3
Gene ID:
Mouse(381917) dynein, axonemal, heavy chain 3
Rat(117249) dynein, axonemal, heavy chain 3
domestic guinea pig(100712961) dynein, axonemal, heavy chain 3
naked mole-rat(101698028) dynein, axonemal, heavy chain 3
sheep(101113559) dynein, axonemal, heavy chain 3
chicken(427004) dynein, axonemal, heavy chain 3
cow(786654) dynein, axonemal, heavy chain 3
Horse(100059138) dynein, axonemal, heavy chain 3
domestic cat(101092726) dynein, axonemal, heavy chain 3
dog(489981) dynein, axonemal, heavy chain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017539 Rosetta Predictions human pricing
XM_001065872 Rosetta Predictions rat pricing
XM_342076 Rosetta Predictions rat pricing
XM_355934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213563 predicted 6589
2 SASI_Hs01_00213564 predicted 11267
3 SASI_Hs01_00213565 predicted 8014
4 SASI_Hs01_00213566 predicted 2894
5 SASI_Hs01_00213568 predicted 5108
6 SASI_Hs02_00350163 predicted 4821
7 SASI_Hs01_00213569 predicted 4338
8 SASI_Hs02_00350164 predicted 2921
9 SASI_Hs01_00213570 predicted 6062
10 SASI_Hs01_00213571 predicted 2930
11 SASI_Hs01_00213567 predicted 860
12 SASI_Hs01_00213572 predicted 3814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315564 predicted 517
2 SASI_Rn02_00315565 predicted 422
3 SASI_Rn02_00315566 predicted 614
4 SASI_Rn02_00315567 predicted 208
5 SASI_Rn02_00315568 predicted 655
6 SASI_Rn02_00315569 predicted 461
7 SASI_Rn02_00315570 predicted 685
8 SASI_Rn02_00315571 predicted 479
9 SASI_Rn02_00315572 predicted 1372
10 SASI_Rn02_00315573 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178238 predicted 2364
2 SASI_Rn01_00178239 predicted 3324
3 SASI_Rn01_00178240 predicted 821
4 SASI_Rn01_00178241 predicted 1173
5 SASI_Rn01_00178242 predicted 2417
6 SASI_Rn01_00178243 predicted 4077
7 SASI_Rn01_00178244 predicted 4216
8 SASI_Rn01_00178245 predicted 273
9 SASI_Rn01_00178246 predicted 1229
10 SASI_Rn01_00178247 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259016 predicted 761
2 SASI_Mm02_00425885 predicted 3874
3 SASI_Mm02_00425886 predicted 4383
4 SASI_Mm02_00425887 predicted 6522
5 SASI_Mm01_00259019 predicted 2874
6 SASI_Mm01_00259020 predicted 1189
7 SASI_Mm02_00425888 predicted 5999
8 SASI_Mm01_00259022 predicted 6033
9 SASI_Mm01_00259023 predicted 2095
10 SASI_Mm02_00425889 predicted 4776
11 SASI_Mm01_00259015 predicted 10612
12 SASI_Mm01_00259017 predicted 11910
13 SASI_Mm01_00259018 predicted 7424
14 SASI_Mm01_00259021 predicted 11535
15 SASI_Mm01_00259024 predicted 3758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017539
VALIDATED
DNAH3 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-3223s1c1
Sequence:CCGGCGCATACAAGACAATTTGGATCTCGAGATCCAAATTGTCTTGTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017539.1-2924s1c1
Sequence:CCGGGCCTCTCAAATATGCTCGAATCTCGAGATTCGAGCATATTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8246s1c1
Sequence:CCGGCCCAAGGAATCAAGAACGAATCTCGAGATTCGTTCTTGATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-283s1c1
Sequence:CCGGGCACCCTTCAAAGAACAGCATCTCGAGATGCTGTTCTTTGAAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8245s1c1
Sequence:CCGGGCCCAAGGAATCAAGAACGAACTCGAGTTCGTTCTTGATTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-10465s1c1
Sequence:CCGGCGGGAGTTCATTGCTGAACATCTCGAGATGTTCAGCAATGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-4851s1c1
Sequence:CCGGGCTCAAGTATCCAGAGGAGAACTCGAGTTCTCCTCTGGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-4915s1c1
Sequence:CCGGGCCAAGTTCTTAGCGCAAGATCTCGAGATCTTGCGCTAAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-2125s1c1
Sequence:CCGGGCAGACAAAGTCAGTGAGGTTCTCGAGAACCTCACTGACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-7049s1c1
Sequence:CCGGCTGGAAAGATAGTCGATGATACTCGAGTATCATCGACTATCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-11130s1c1
Sequence:CCGGCCAGATGTTTCTCAATGACTACTCGAGTAGTCATTGAGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-3053s21c1
Sequence:CCGGTGACGTTCAGCTTCGTGAAATCTCGAGATTTCACGAAGCTGAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-7799s21c1
Sequence:CCGGTAGAGTTGGTGGCTAACAAATCTCGAGATTTGTTAGCCACCAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-1918s21c1
Sequence:CCGGACGAAGATCAATGCCATAAAGCTCGAGCTTTATGGCATTGATCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017539
VALIDATED
DNAH3 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-3223s1c1
Sequence:CCGGCGCATACAAGACAATTTGGATCTCGAGATCCAAATTGTCTTGTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017539.1-2924s1c1
Sequence:CCGGGCCTCTCAAATATGCTCGAATCTCGAGATTCGAGCATATTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8246s1c1
Sequence:CCGGCCCAAGGAATCAAGAACGAATCTCGAGATTCGTTCTTGATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-283s1c1
Sequence:CCGGGCACCCTTCAAAGAACAGCATCTCGAGATGCTGTTCTTTGAAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8245s1c1
Sequence:CCGGGCCCAAGGAATCAAGAACGAACTCGAGTTCGTTCTTGATTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-10465s1c1
Sequence:CCGGCGGGAGTTCATTGCTGAACATCTCGAGATGTTCAGCAATGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-4851s1c1
Sequence:CCGGGCTCAAGTATCCAGAGGAGAACTCGAGTTCTCCTCTGGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-4915s1c1
Sequence:CCGGGCCAAGTTCTTAGCGCAAGATCTCGAGATCTTGCGCTAAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-2125s1c1
Sequence:CCGGGCAGACAAAGTCAGTGAGGTTCTCGAGAACCTCACTGACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-7049s1c1
Sequence:CCGGCTGGAAAGATAGTCGATGATACTCGAGTATCATCGACTATCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-11130s1c1
Sequence:CCGGCCAGATGTTTCTCAATGACTACTCGAGTAGTCATTGAGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-3053s21c1
Sequence:CCGGTGACGTTCAGCTTCGTGAAATCTCGAGATTTCACGAAGCTGAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-7799s21c1
Sequence:CCGGTAGAGTTGGTGGCTAACAAATCTCGAGATTTGTTAGCCACCAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-1918s21c1
Sequence:CCGGACGAAGATCAATGCCATAAAGCTCGAGCTTTATGGCATTGATCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017539
VALIDATED
DNAH3 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-3223s1c1
Sequence:CCGGCGCATACAAGACAATTTGGATCTCGAGATCCAAATTGTCTTGTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017539.1-2924s1c1
Sequence:CCGGGCCTCTCAAATATGCTCGAATCTCGAGATTCGAGCATATTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8246s1c1
Sequence:CCGGCCCAAGGAATCAAGAACGAATCTCGAGATTCGTTCTTGATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-283s1c1
Sequence:CCGGGCACCCTTCAAAGAACAGCATCTCGAGATGCTGTTCTTTGAAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-8245s1c1
Sequence:CCGGGCCCAAGGAATCAAGAACGAACTCGAGTTCGTTCTTGATTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-10465s1c1
Sequence:CCGGCGGGAGTTCATTGCTGAACATCTCGAGATGTTCAGCAATGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-4851s1c1
Sequence:CCGGGCTCAAGTATCCAGAGGAGAACTCGAGTTCTCCTCTGGATACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-4915s1c1
Sequence:CCGGGCCAAGTTCTTAGCGCAAGATCTCGAGATCTTGCGCTAAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-2125s1c1
Sequence:CCGGGCAGACAAAGTCAGTGAGGTTCTCGAGAACCTCACTGACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017539.1-7049s1c1
Sequence:CCGGCTGGAAAGATAGTCGATGATACTCGAGTATCATCGACTATCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017539.1-11130s1c1
Sequence:CCGGCCAGATGTTTCTCAATGACTACTCGAGTAGTCATTGAGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-3053s21c1
Sequence:CCGGTGACGTTCAGCTTCGTGAAATCTCGAGATTTCACGAAGCTGAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-7799s21c1
Sequence:CCGGTAGAGTTGGTGGCTAACAAATCTCGAGATTTGTTAGCCACCAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017539.1-1918s21c1
Sequence:CCGGACGAAGATCAATGCCATAAAGCTCGAGCTTTATGGCATTGATCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks