EMAIL THIS PAGE TO A FRIEND

DNAH5

dynein, axonemal, heavy chain 5

56 Gene Product Result for
Synonyms: CILD3 DNAHC5 HL1 KTGNR PCD
UniProtKB ID: Q8TE73, Q92860, Q96L74, Q9H5S7, Q9HCG9
Gene ID:
Human(1767) Summary: This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
Mouse(110082) dynein, axonemal, heavy chain 5
Rat(294854) dynein, axonemal, heavy chain 5
Zebrafish(563936) dynein, axonemal, heavy chain 5
cow(100298754) dynein, axonemal, heavy chain 5
Horse(100070308) dynein, axonemal, heavy chain 5
domestic cat(101091923) dynein, axonemal, heavy chain 5
dog(606983) dynein, axonemal, heavy chain 5
chicken(420921) dynein, axonemal, heavy chain 5
sheep(101104179) dynein, axonemal, heavy chain 5
naked mole-rat(101697713) dynein, axonemal, heavy chain 5
domestic guinea pig(100718933) dynein, axonemal, heavy chain 5
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001369 Rosetta Predictions human pricing
XM_001065087 Rosetta Predictions rat pricing
XM_226891 Rosetta Predictions rat pricing
NM_133365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331715 predicted 13999
2 SASI_Hs01_00227379 predicted 753
3 SASI_Hs01_00227380 predicted 9724
4 SASI_Hs01_00227381 predicted 13438
5 SASI_Hs01_00227383 predicted 1669
6 SASI_Hs01_00227384 predicted 12485
7 SASI_Hs01_00227385 predicted 11001
8 SASI_Hs01_00227386 predicted 5312
9 SASI_Hs01_00227387 predicted 7676
10 SASI_Hs01_00227388 predicted 6713
11 SASI_Hs01_00227382 predicted 2971
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312822 predicted 3011
2 SASI_Rn02_00312823 predicted 3002
3 SASI_Rn02_00312824 predicted 12084
4 SASI_Rn02_00312825 predicted 6667
5 SASI_Rn02_00312826 predicted 1976
6 SASI_Rn02_00312827 predicted 4485
7 SASI_Rn02_00312828 predicted 6539
8 SASI_Rn02_00312829 predicted 926
9 SASI_Rn02_00312830 predicted 2202
10 SASI_Rn02_00312831 predicted 5467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383941 predicted 3018
2 SASI_Rn02_00383942 predicted 3000
3 SASI_Rn02_00383943 predicted 12081
4 SASI_Rn02_00383944 predicted 13733
5 SASI_Rn02_00383945 predicted 1971
6 SASI_Rn02_00383946 predicted 4489
7 SASI_Rn02_00383947 predicted 6539
8 SASI_Rn02_00383948 predicted 931
9 SASI_Rn02_00383949 predicted 2196
10 SASI_Rn02_00383950 predicted 5470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072147 predicted 4024
2 SASI_Mm01_00072148 predicted 11857
3 SASI_Mm02_00338547 predicted 4731
4 SASI_Mm01_00072149 predicted 5462
5 SASI_Mm01_00072150 predicted 8729
6 SASI_Mm01_00072151 predicted 2192
7 SASI_Mm01_00072152 predicted 8887
8 SASI_Mm01_00072155 predicted 4328
9 SASI_Mm01_00072156 predicted 8673
10 SASI_Mm02_00338548 predicted 1297
11 SASI_Mm01_00072153 predicted 1195
12 SASI_Mm01_00072154 predicted 4933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001369
DNAH5 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-5698s21c1
Sequence:CCGGTACGAGACTCTGATTACTATTCTCGAGAATAGTAATCAGAGTCTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-2430s21c1
Sequence:CCGGACTGAATATTGAGGCTTATTTCTCGAGAAATAAGCCTCAATATTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-145s21c1
Sequence:CCGGGCGAGGCATAACTACTTATTTCTCGAGAAATAAGTAGTTATGCCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-11542s1c1
Sequence:CCGGCGCTTGGTTAATGAGATGTATCTCGAGATACATCTCATTAACCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-6964s1c1
Sequence:CCGGGCCACAAATGACTGGACTGATCTCGAGATCAGTCCAGTCATTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-5857s1c1
Sequence:CCGGGCGTTCATATACCAGAATGAACTCGAGTTCATTCTGGTATATGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-12769s1c1
Sequence:CCGGCGCTACATGATAGGAGAGATTCTCGAGAATCTCTCCTATCATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-1483s1c1
Sequence:CCGGGCCAAGATAATAGACATCTTTCTCGAGAAAGATGTCTATTATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001369
DNAH5 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-5698s21c1
Sequence:CCGGTACGAGACTCTGATTACTATTCTCGAGAATAGTAATCAGAGTCTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-2430s21c1
Sequence:CCGGACTGAATATTGAGGCTTATTTCTCGAGAAATAAGCCTCAATATTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-145s21c1
Sequence:CCGGGCGAGGCATAACTACTTATTTCTCGAGAAATAAGTAGTTATGCCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-11542s1c1
Sequence:CCGGCGCTTGGTTAATGAGATGTATCTCGAGATACATCTCATTAACCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-6964s1c1
Sequence:CCGGGCCACAAATGACTGGACTGATCTCGAGATCAGTCCAGTCATTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-5857s1c1
Sequence:CCGGGCGTTCATATACCAGAATGAACTCGAGTTCATTCTGGTATATGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-12769s1c1
Sequence:CCGGCGCTACATGATAGGAGAGATTCTCGAGAATCTCTCCTATCATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-1483s1c1
Sequence:CCGGGCCAAGATAATAGACATCTTTCTCGAGAAAGATGTCTATTATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001369
DNAH5 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-5698s21c1
Sequence:CCGGTACGAGACTCTGATTACTATTCTCGAGAATAGTAATCAGAGTCTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-2430s21c1
Sequence:CCGGACTGAATATTGAGGCTTATTTCTCGAGAAATAAGCCTCAATATTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001369.2-145s21c1
Sequence:CCGGGCGAGGCATAACTACTTATTTCTCGAGAAATAAGTAGTTATGCCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-11542s1c1
Sequence:CCGGCGCTTGGTTAATGAGATGTATCTCGAGATACATCTCATTAACCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-6964s1c1
Sequence:CCGGGCCACAAATGACTGGACTGATCTCGAGATCAGTCCAGTCATTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-5857s1c1
Sequence:CCGGGCGTTCATATACCAGAATGAACTCGAGTTCATTCTGGTATATGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-12769s1c1
Sequence:CCGGCGCTACATGATAGGAGAGATTCTCGAGAATCTCTCCTATCATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001369.1-1483s1c1
Sequence:CCGGGCCAAGATAATAGACATCTTTCTCGAGAAAGATGTCTATTATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133365
DNAH5 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133365.1-14083s1c1
Sequence:CCGGGAAACATATGATCCAAAGTATCTCGAGATACTTTGGATCATATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-13057s1c1
Sequence:CCGGCCAAGGATACAACATTCCAAACTCGAGTTTGGAATGTTGTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-4318s1c1
Sequence:CCGGCCAGAATCAATTCGATAACATCTCGAGATGTTATCGAATTGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-12150s1c1
Sequence:CCGGCGCTTCCAAATGCCTACGATACTCGAGTATCGTAGGCATTTGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-5207s1c1
Sequence:CCGGCGGGCACATGAGATACCAAATCTCGAGATTTGGTATCTCATGTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133365
DNAH5 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133365.1-14083s1c1
Sequence:CCGGGAAACATATGATCCAAAGTATCTCGAGATACTTTGGATCATATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-13057s1c1
Sequence:CCGGCCAAGGATACAACATTCCAAACTCGAGTTTGGAATGTTGTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-4318s1c1
Sequence:CCGGCCAGAATCAATTCGATAACATCTCGAGATGTTATCGAATTGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-12150s1c1
Sequence:CCGGCGCTTCCAAATGCCTACGATACTCGAGTATCGTAGGCATTTGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-5207s1c1
Sequence:CCGGCGGGCACATGAGATACCAAATCTCGAGATTTGGTATCTCATGTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133365
DNAH5 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133365.1-14083s1c1
Sequence:CCGGGAAACATATGATCCAAAGTATCTCGAGATACTTTGGATCATATGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-13057s1c1
Sequence:CCGGCCAAGGATACAACATTCCAAACTCGAGTTTGGAATGTTGTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-4318s1c1
Sequence:CCGGCCAGAATCAATTCGATAACATCTCGAGATGTTATCGAATTGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-12150s1c1
Sequence:CCGGCGCTTCCAAATGCCTACGATACTCGAGTATCGTAGGCATTTGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133365.1-5207s1c1
Sequence:CCGGCGGGCACATGAGATACCAAATCTCGAGATTTGGTATCTCATGTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)