EMAIL THIS PAGE TO A FRIEND

DNAH6

dynein, axonemal, heavy chain 6

62 Gene Product Result for
Synonyms: DNHL1 Dnahc6 HL-2 HL2
Gene ID:
Human(1768) Summary: Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH6 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]
Mouse(330355) dynein, axonemal, heavy chain 6
Rat(117250) dynein, axonemal, heavy chain 6
domestic guinea pig(100730078) dynein, axonemal, heavy chain 6
naked mole-rat(101711385) dynein, axonemal, heavy chain 6
sheep(101122589) dynein, axonemal, heavy chain 6
Zebrafish(100148193) dynein, axonemal, heavy chain 6
dog(475774) dynein, axonemal, heavy chain 6
Horse(100067558) dynein, axonemal, heavy chain 6
cow(538058) dynein, axonemal, heavy chain 6
domestic cat(101089345) dynein, axonemal, heavy chain 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066791 MISSION® esiRNA esiRNA targeting mouse Dnahc6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001069941 Rosetta Predictions rat pricing
XM_342709 Rosetta Predictions rat pricing
XM_001478021 Rosetta Predictions mouse pricing
XM_913416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329873 predicted 336
2 SASI_Rn02_00329874 predicted 1777
3 SASI_Rn02_00329875 predicted 8883
4 SASI_Rn02_00329876 predicted 4191
5 SASI_Rn02_00329877 predicted 1910
6 SASI_Rn02_00329878 predicted 2303
7 SASI_Rn02_00329879 predicted 8543
8 SASI_Rn02_00329880 predicted 800
9 SASI_Rn02_00329881 predicted 6780
10 SASI_Rn02_00329882 predicted 6655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394701 predicted 6541
2 SASI_Rn02_00394702 predicted 2972
3 SASI_Rn02_00394703 predicted 4892
4 SASI_Rn02_00394704 predicted 8803
5 SASI_Rn02_00394705 predicted 4356
6 SASI_Rn02_00394706 predicted 4191
7 SASI_Rn02_00394707 predicted 9232
8 SASI_Rn02_00394708 predicted 9211
9 SASI_Rn02_00394709 predicted 8467
10 SASI_Rn02_00394710 predicted 7541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399792 predicted 6831
2 SASI_Mm02_00399793 predicted 7118
3 SASI_Mm02_00399794 predicted 7626
4 SASI_Mm02_00399795 predicted 7167
5 SASI_Mm02_00399796 predicted 9082
6 SASI_Mm02_00399797 predicted 4366
7 SASI_Mm02_00399798 predicted 4902
8 SASI_Mm02_00399799 predicted 6781
9 SASI_Mm02_00399800 predicted 2622
10 SASI_Mm02_00399801 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272366 predicted 6839
2 SASI_Mm01_00272367 predicted 7344
3 SASI_Mm01_00272368 predicted 6883
4 SASI_Mm02_00437692 predicted 709
5 SASI_Mm01_00272369 predicted 8798
6 SASI_Mm02_00437693 predicted 11755
7 SASI_Mm01_00272372 predicted 8354
8 SASI_Mm01_00272373 predicted 9231
9 SASI_Mm01_00272374 predicted 11492
10 SASI_Mm02_00437694 predicted 2342
11 SASI_Mm01_00272370 predicted 6416
12 SASI_Mm01_00272371 predicted 5329
13 SASI_Mm01_00272375 predicted 5152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164669
DNAH6 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-3057s21c1
Sequence:CCGGGTCCGAACTGCACGTCTTTAACTCGAGTTAAAGACGTGCAGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6361s21c1
Sequence:CCGGGGCGTTGGCAAGTCCGTTATTCTCGAGAATAACGGACTTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7221s21c1
Sequence:CCGGTGACCGCATCTACGATGATTTCTCGAGAAATCATCGTAGATGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6787s21c1
Sequence:CCGGCACAGTCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7064s21c1
Sequence:CCGGTCCATGACCGCCTGATCAATACTCGAGTATTGATCAGGCGGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-1206s21c1
Sequence:CCGGCTTACGCGCTGCGGGATTTATCTCGAGATAAATCCCGCAGCGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-2781s21c1
Sequence:CCGGGGAATGGCTGAAGTCCAAATTCTCGAGAATTTGGACTTCAGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-592s21c1
Sequence:CCGGGACCGAGAAGAAGTCATTAAACTCGAGTTTAATGACTTCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164669
DNAH6 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-3057s21c1
Sequence:CCGGGTCCGAACTGCACGTCTTTAACTCGAGTTAAAGACGTGCAGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6361s21c1
Sequence:CCGGGGCGTTGGCAAGTCCGTTATTCTCGAGAATAACGGACTTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7221s21c1
Sequence:CCGGTGACCGCATCTACGATGATTTCTCGAGAAATCATCGTAGATGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6787s21c1
Sequence:CCGGCACAGTCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7064s21c1
Sequence:CCGGTCCATGACCGCCTGATCAATACTCGAGTATTGATCAGGCGGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-1206s21c1
Sequence:CCGGCTTACGCGCTGCGGGATTTATCTCGAGATAAATCCCGCAGCGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-2781s21c1
Sequence:CCGGGGAATGGCTGAAGTCCAAATTCTCGAGAATTTGGACTTCAGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-592s21c1
Sequence:CCGGGACCGAGAAGAAGTCATTAAACTCGAGTTTAATGACTTCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164669
DNAH6 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-3057s21c1
Sequence:CCGGGTCCGAACTGCACGTCTTTAACTCGAGTTAAAGACGTGCAGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6361s21c1
Sequence:CCGGGGCGTTGGCAAGTCCGTTATTCTCGAGAATAACGGACTTGCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7221s21c1
Sequence:CCGGTGACCGCATCTACGATGATTTCTCGAGAAATCATCGTAGATGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-6787s21c1
Sequence:CCGGCACAGTCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-7064s21c1
Sequence:CCGGTCCATGACCGCCTGATCAATACTCGAGTATTGATCAGGCGGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-1206s21c1
Sequence:CCGGCTTACGCGCTGCGGGATTTATCTCGAGATAAATCCCGCAGCGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-2781s21c1
Sequence:CCGGGGAATGGCTGAAGTCCAAATTCTCGAGAATTTGGACTTCAGCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164669.1-592s21c1
Sequence:CCGGGACCGAGAAGAAGTCATTAAACTCGAGTTTAATGACTTCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks