EMAIL THIS PAGE TO A FRIEND

DNAH7

dynein, axonemal, heavy chain 7

45 Gene Product Result for
Gene ID:
Human(56171) Summary: DNAH7 is a component of the inner dynein arm of ciliary axonemes (Zhang et al., 2002 [PubMed 11877439]
Rat(252893) dynein, axonemal, heavy chain 7
Zebrafish(561639) dynein, axonemal, heavy chain 7
dog(488452) dynein, axonemal, heavy chain 7
cow(517781) dynein, axonemal, heavy chain 7
domestic cat(101082681) dynein, axonemal, heavy chain 7
chicken(424048) dynein, axonemal, heavy chain 7
sheep(101119280) dynein, axonemal, heavy chain 7
naked mole-rat(101714163) dynein, axonemal, heavy chain 7
domestic guinea pig(100724900) dynein, axonemal, heavy chain 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018897 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071371 MISSION® esiRNA esiRNA human DNAH7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018897 Rosetta Predictions human pricing
XM_001065965 Rosetta Predictions rat pricing
XM_343569 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226005 predicted 4821
2 SASI_Hs01_00226006 predicted 6092
3 SASI_Hs01_00226007 predicted 7411
4 SASI_Hs02_00352321 predicted 7954
5 SASI_Hs01_00226008 predicted 5723
6 SASI_Hs01_00226009 predicted 6403
7 SASI_Hs01_00226010 predicted 11979
8 SASI_Hs02_00352322 predicted 4802
9 SASI_Hs02_00352323 predicted 1687
10 SASI_Hs01_00226013 predicted 342
11 SASI_Hs01_00226011 predicted 6973
12 SASI_Hs01_00226012 predicted 10731
13 SASI_Hs01_00226014 predicted 8365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315924 predicted 4285
2 SASI_Rn02_00315925 predicted 9112
3 SASI_Rn02_00315926 predicted 4169
4 SASI_Rn02_00315927 predicted 2538
5 SASI_Rn02_00315928 predicted 3565
6 SASI_Rn02_00315929 predicted 7852
7 SASI_Rn02_00315930 predicted 5744
8 SASI_Rn02_00315931 predicted 1659
9 SASI_Rn02_00315932 predicted 7298
10 SASI_Rn02_00315933 predicted 11649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141256 predicted 3324
2 SASI_Rn01_00141257 predicted 8971
3 SASI_Rn01_00141258 predicted 10095
4 SASI_Rn01_00141259 predicted 2458
5 SASI_Rn01_00141260 predicted 9941
6 SASI_Rn01_00141261 predicted 3494
7 SASI_Rn01_00141262 predicted 1581
8 SASI_Rn01_00141263 predicted 235
9 SASI_Rn01_00141264 predicted 11505
10 SASI_Rn01_00141265 predicted 9291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018897
DNAH7 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-11497s21c1
Sequence:CCGGTAAGAGATTCGTGCGTAAATACTCGAGTATTTACGCACGAATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-1473s21c1
Sequence:CCGGACAACCTTGAAGCCCATAATTCTCGAGAATTATGGGCTTCAAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-2736s21c1
Sequence:CCGGATGAATCTGGAACCATATATACTCGAGTATATATGGTTCCAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-2293s1c1
Sequence:CCGGGCAGATAAGATTGAGCAGTTTCTCGAGAAACTGCTCAATCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-5535s1c1
Sequence:CCGGCCGGTCCTTAATGAATCTAATCTCGAGATTAGATTCATTAAGGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-9073s1c1
Sequence:CCGGCCTCAAAGTCAGGCTAATAAACTCGAGTTTATTAGCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018897.1-12180s1c1
Sequence:CCGGCATCATTTCCTTGTTCCTATTCTCGAGAATAGGAACAAGGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018897
DNAH7 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-11497s21c1
Sequence:CCGGTAAGAGATTCGTGCGTAAATACTCGAGTATTTACGCACGAATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-1473s21c1
Sequence:CCGGACAACCTTGAAGCCCATAATTCTCGAGAATTATGGGCTTCAAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-2736s21c1
Sequence:CCGGATGAATCTGGAACCATATATACTCGAGTATATATGGTTCCAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-2293s1c1
Sequence:CCGGGCAGATAAGATTGAGCAGTTTCTCGAGAAACTGCTCAATCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-5535s1c1
Sequence:CCGGCCGGTCCTTAATGAATCTAATCTCGAGATTAGATTCATTAAGGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-9073s1c1
Sequence:CCGGCCTCAAAGTCAGGCTAATAAACTCGAGTTTATTAGCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018897.1-12180s1c1
Sequence:CCGGCATCATTTCCTTGTTCCTATTCTCGAGAATAGGAACAAGGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018897
DNAH7 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-11497s21c1
Sequence:CCGGTAAGAGATTCGTGCGTAAATACTCGAGTATTTACGCACGAATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-1473s21c1
Sequence:CCGGACAACCTTGAAGCCCATAATTCTCGAGAATTATGGGCTTCAAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018897.2-2736s21c1
Sequence:CCGGATGAATCTGGAACCATATATACTCGAGTATATATGGTTCCAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-2293s1c1
Sequence:CCGGGCAGATAAGATTGAGCAGTTTCTCGAGAAACTGCTCAATCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-5535s1c1
Sequence:CCGGCCGGTCCTTAATGAATCTAATCTCGAGATTAGATTCATTAAGGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018897.1-9073s1c1
Sequence:CCGGCCTCAAAGTCAGGCTAATAAACTCGAGTTTATTAGCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018897.1-12180s1c1
Sequence:CCGGCATCATTTCCTTGTTCCTATTCTCGAGAATAGGAACAAGGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks