EMAIL THIS PAGE TO A FRIEND

DNAH8

dynein, axonemal, heavy chain 8

58 Gene Product Result for
Synonyms: ATPase hdhc9
Gene ID:
Human(1769) Summary: The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Mouse(13417) dynein, axonemal, heavy chain 8
Rat(207117) dynein, axonemal, heavy chain 8
cow(525414) dynein, axonemal, heavy chain 8
Horse(100065248) dynein, axonemal, heavy chain 8
dog(474895) dynein, axonemal, heavy chain 8
domestic cat(101095258) dynein, axonemal, heavy chain 8
sheep(101105194) dynein, axonemal, heavy chain 8
Domestic Rabbit(100345687) dynein, axonemal, heavy chain 8
domestic guinea pig(101787412) dynein, axonemal, heavy chain 8
naked mole-rat(101699441) dynein, axonemal, heavy chain 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041571 MISSION® esiRNA esiRNA human DNAH5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001371 Rosetta Predictions human pricing
XM_001079004 Rosetta Predictions rat pricing
XM_228058 Rosetta Predictions rat pricing
NM_013811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148667 predicted 4008
2 SASI_Hs02_00331716 predicted 5838
3 SASI_Hs01_00148668 predicted 3758
4 SASI_Hs01_00148669 predicted 1052
5 SASI_Hs02_00331717 predicted 11469
6 SASI_Hs02_00331718 predicted 4443
7 SASI_Hs02_00331719 predicted 9299
8 SASI_Hs01_00148671 predicted 3832
9 SASI_Hs01_00148672 predicted 4678
10 SASI_Hs01_00148673 predicted 12815
11 SASI_Hs01_00148665 predicted 10646
12 SASI_Hs01_00148666 predicted 2001
13 SASI_Hs01_00148670 predicted 6702
14 SASI_Hs01_00148674 predicted 6667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362818 predicted 7458
2 SASI_Rn02_00362819 predicted 7504
3 SASI_Rn02_00362820 predicted 8225
4 SASI_Rn02_00362821 predicted 7160
5 SASI_Rn02_00362822 predicted 3540
6 SASI_Rn02_00362823 predicted 8332
7 SASI_Rn02_00362824 predicted 12490
8 SASI_Rn02_00362825 predicted 5787
9 SASI_Rn02_00362826 predicted 1074
10 SASI_Rn02_00362827 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384881 predicted 217
2 SASI_Rn02_00384882 predicted 4682
3 SASI_Rn02_00384883 predicted 2177
4 SASI_Rn02_00384884 predicted 2619
5 SASI_Rn02_00384885 predicted 3681
6 SASI_Rn02_00384886 predicted 4909
7 SASI_Rn02_00384887 predicted 2464
8 SASI_Rn02_00384888 predicted 1350
9 SASI_Rn02_00384889 predicted 230
10 SASI_Rn02_00384890 predicted 4546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183766 predicted 12809
2 SASI_Mm01_00183767 predicted 13812
3 SASI_Mm01_00183768 predicted 4984
4 SASI_Mm01_00183770 predicted 5142
5 SASI_Mm01_00183771 predicted 4989
6 SASI_Mm02_00322771 predicted 9537
7 SASI_Mm01_00183772 predicted 1131
8 SASI_Mm01_00183773 predicted 1641
9 SASI_Mm01_00183774 predicted 8353
10 SASI_Mm01_00183775 predicted 12964
11 SASI_Mm01_00183769 predicted 11810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001371
DNAH8 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-1055s21c1
Sequence:CCGGAGATCGAACAGGTACTTATTGCTCGAGCAATAAGTACCTGTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-3928s21c1
Sequence:CCGGTCTAGACCTATTCGTGATTTACTCGAGTAAATCACGAATAGGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-12875s21c1
Sequence:CCGGACCTTGATGAATGCGATATTACTCGAGTAATATCGCATTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-1833s1c1
Sequence:CCGGCGGATAAGTGAGCCCATCAATCTCGAGATTGATGGGCTCACTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-840s1c1
Sequence:CCGGCCAAGTTGTAAGGCTGTCATACTCGAGTATGACAGCCTTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-10821s1c1
Sequence:CCGGCCAGCCTTGGATAATGTATTACTCGAGTAATACATTATCCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-852s1c1
Sequence:CCGGGCTGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13592s1c1
Sequence:CCGGGCTGTATGTGTGTCCTATTTACTCGAGTAAATAGGACACACATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-8332s1c1
Sequence:CCGGGCAGAGTAATTGCAGACAGATCTCGAGATCTGTCTGCAATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13625s1c1
Sequence:CCGGGCGAACTGATTTGACCTTCATCTCGAGATGAAGGTCAAATCAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001371
DNAH8 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-1055s21c1
Sequence:CCGGAGATCGAACAGGTACTTATTGCTCGAGCAATAAGTACCTGTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-3928s21c1
Sequence:CCGGTCTAGACCTATTCGTGATTTACTCGAGTAAATCACGAATAGGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-12875s21c1
Sequence:CCGGACCTTGATGAATGCGATATTACTCGAGTAATATCGCATTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-1833s1c1
Sequence:CCGGCGGATAAGTGAGCCCATCAATCTCGAGATTGATGGGCTCACTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-840s1c1
Sequence:CCGGCCAAGTTGTAAGGCTGTCATACTCGAGTATGACAGCCTTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-10821s1c1
Sequence:CCGGCCAGCCTTGGATAATGTATTACTCGAGTAATACATTATCCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-852s1c1
Sequence:CCGGGCTGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13592s1c1
Sequence:CCGGGCTGTATGTGTGTCCTATTTACTCGAGTAAATAGGACACACATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-8332s1c1
Sequence:CCGGGCAGAGTAATTGCAGACAGATCTCGAGATCTGTCTGCAATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13625s1c1
Sequence:CCGGGCGAACTGATTTGACCTTCATCTCGAGATGAAGGTCAAATCAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001371
DNAH8 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-1055s21c1
Sequence:CCGGAGATCGAACAGGTACTTATTGCTCGAGCAATAAGTACCTGTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-3928s21c1
Sequence:CCGGTCTAGACCTATTCGTGATTTACTCGAGTAAATCACGAATAGGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001371.2-12875s21c1
Sequence:CCGGACCTTGATGAATGCGATATTACTCGAGTAATATCGCATTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-1833s1c1
Sequence:CCGGCGGATAAGTGAGCCCATCAATCTCGAGATTGATGGGCTCACTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-840s1c1
Sequence:CCGGCCAAGTTGTAAGGCTGTCATACTCGAGTATGACAGCCTTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-10821s1c1
Sequence:CCGGCCAGCCTTGGATAATGTATTACTCGAGTAATACATTATCCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-852s1c1
Sequence:CCGGGCTGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13592s1c1
Sequence:CCGGGCTGTATGTGTGTCCTATTTACTCGAGTAAATAGGACACACATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-8332s1c1
Sequence:CCGGGCAGAGTAATTGCAGACAGATCTCGAGATCTGTCTGCAATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001371.1-13625s1c1
Sequence:CCGGGCGAACTGATTTGACCTTCATCTCGAGATGAAGGTCAAATCAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013811
DNAH8 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-1589s1c1
Sequence:CCGGGCCGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-776s1c1
Sequence:CCGGCCCTCGCATAAATACATATTTCTCGAGAAATATGTATTTATGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-14176s1c1
Sequence:CCGGCGTGTATATTTACGGGCTGTACTCGAGTACAGCCCGTAAATATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-13307s1c1
Sequence:CCGGCGGTACATGATTGGTGAAGTACTCGAGTACTTCACCAATCATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-2410s1c1
Sequence:CCGGCCTGGAAATCAATCACACAATCTCGAGATTGTGTGATTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013811
DNAH8 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-1589s1c1
Sequence:CCGGGCCGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-776s1c1
Sequence:CCGGCCCTCGCATAAATACATATTTCTCGAGAAATATGTATTTATGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-14176s1c1
Sequence:CCGGCGTGTATATTTACGGGCTGTACTCGAGTACAGCCCGTAAATATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-13307s1c1
Sequence:CCGGCGGTACATGATTGGTGAAGTACTCGAGTACTTCACCAATCATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-2410s1c1
Sequence:CCGGCCTGGAAATCAATCACACAATCTCGAGATTGTGTGATTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013811
DNAH8 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-1589s1c1
Sequence:CCGGGCCGTCATAAATGTGCTAAATCTCGAGATTTAGCACATTTATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-776s1c1
Sequence:CCGGCCCTCGCATAAATACATATTTCTCGAGAAATATGTATTTATGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-14176s1c1
Sequence:CCGGCGTGTATATTTACGGGCTGTACTCGAGTACAGCCCGTAAATATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-13307s1c1
Sequence:CCGGCGGTACATGATTGGTGAAGTACTCGAGTACTTCACCAATCATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013811.1-2410s1c1
Sequence:CCGGCCTGGAAATCAATCACACAATCTCGAGATTGTGTGATTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks