EMAIL THIS PAGE TO A FRIEND

DNAH9

dynein, axonemal, heavy chain 9

141 Gene Product Result for
Synonyms: DNAH17L DNEL1 DYH9 Dnahc9 HL-20 HL20
UniProtKB ID: Q9NYC9, A2VCQ8, O15064, O95494, Q9NQ28
Gene ID:
Human(1770) Summary: This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(237806) dynein, axonemal, heavy chain 9
Rat(117251) dynein, axonemal, heavy chain 9
naked mole-rat(101705214) dynein, axonemal, heavy chain 9
domestic guinea pig(100734233) dynein, axonemal, heavy chain 9
sheep(101114286) dynein, axonemal, heavy chain 9
Zebrafish(266676) dynein, axonemal, heavy polypeptide 9
chicken(417314) dynein, axonemal, heavy chain 9
Zebrafish(100536235) dynein, axonemal, heavy chain 9
cow(790891) dynein, axonemal, heavy chain 9
Horse(100073091) dynein, axonemal, heavy chain 9
domestic cat(101086188) dynein, axonemal, heavy chain 9
dog(489507) dynein, axonemal, heavy chain 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001372 Rosetta Predictions human pricing
NM_004662 Rosetta Predictions human pricing
XM_001078646 Rosetta Predictions rat pricing
XM_213354 Rosetta Predictions rat pricing
NM_001099633 Rosetta Predictions mouse pricing
XM_110968 Rosetta Predictions mouse pricing
XM_901600 Rosetta Predictions mouse pricing
XM_901603 Rosetta Predictions mouse pricing
XM_917040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226559 predicted 13395
2 SASI_Hs01_00226560 predicted 12155
3 SASI_Hs01_00226561 predicted 12016
4 SASI_Hs01_00226564 predicted 11917
5 SASI_Hs01_00226565 predicted 11829
6 SASI_Hs02_00331720 predicted 13252
7 SASI_Hs01_00226566 predicted 11468
8 SASI_Hs01_00226567 predicted 11644
9 SASI_Hs01_00226568 predicted 12461
10 SASI_Hs02_00331721 predicted 11242
11 SASI_Hs01_00226562 predicted 11831
12 SASI_Hs01_00226563 predicted 12002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110681 predicted 2791
2 SASI_Hs01_00110682 predicted 1548
3 SASI_Hs01_00110683 predicted 1407
4 SASI_Hs01_00110686 predicted 1307
5 SASI_Hs01_00110687 predicted 1228
6 SASI_Hs02_00338080 predicted 2643
7 SASI_Hs01_00110688 predicted 865
8 SASI_Hs01_00110689 predicted 1049
9 SASI_Hs01_00110690 predicted 1866
10 SASI_Hs02_00338081 predicted 645
11 SASI_Hs01_00110684 predicted 1228
12 SASI_Hs01_00110685 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361578 predicted 10890
2 SASI_Rn02_00361579 predicted 5344
3 SASI_Rn02_00361580 predicted 5407
4 SASI_Rn02_00361581 predicted 6955
5 SASI_Rn02_00361582 predicted 8289
6 SASI_Rn02_00361583 predicted 4369
7 SASI_Rn02_00361584 predicted 11155
8 SASI_Rn02_00361585 predicted 11884
9 SASI_Rn02_00361586 predicted 9993
10 SASI_Rn02_00361587 predicted 9382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374559 predicted 5031
2 SASI_Rn02_00374560 predicted 2226
3 SASI_Rn02_00374561 predicted 885
4 SASI_Rn02_00374562 predicted 4841
5 SASI_Rn02_00374563 predicted 1096
6 SASI_Rn02_00374564 predicted 5293
7 SASI_Rn02_00374565 predicted 6022
8 SASI_Rn02_00374566 predicted 3276
9 SASI_Rn02_00374567 predicted 4137
10 SASI_Rn02_00374568 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301875 predicted 3094
2 SASI_Mm02_00301876 predicted 3024
3 SASI_Mm02_00301877 predicted 11148
4 SASI_Mm02_00301878 predicted 7040
5 SASI_Mm02_00301879 predicted 3187
6 SASI_Mm02_00301880 predicted 6741
7 SASI_Mm02_00301881 predicted 12388
8 SASI_Mm02_00301882 predicted 2701
9 SASI_Mm02_00301883 predicted 10215
10 SASI_Mm02_00301884 predicted 11252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247405 predicted 3026
2 SASI_Mm01_00247406 predicted 2501
3 SASI_Mm01_00247407 predicted 3141
4 SASI_Mm01_00247408 predicted 11158
5 SASI_Mm01_00247409 predicted 7043
6 SASI_Mm01_00247410 predicted 3192
7 SASI_Mm01_00247411 predicted 6746
8 SASI_Mm01_00247412 predicted 2709
9 SASI_Mm01_00247413 predicted 10220
10 SASI_Mm01_00247414 predicted 11254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238056 predicted 886
2 SASI_Mm01_00238057 predicted 1017
3 SASI_Mm01_00238058 predicted 1195
4 SASI_Mm01_00238059 predicted 888
5 SASI_Mm01_00238060 predicted 703
6 SASI_Mm01_00238061 predicted 1266
7 SASI_Mm01_00238062 predicted 943
8 SASI_Mm01_00238063 predicted 1595
9 SASI_Mm01_00238064 predicted 600
10 SASI_Mm01_00238065 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258032 predicted 779
2 SASI_Mm01_00258033 predicted 1377
3 SASI_Mm01_00258034 predicted 897
4 SASI_Mm01_00258035 predicted 1547
5 SASI_Mm01_00258036 predicted 1528
6 SASI_Mm01_00258037 predicted 1588
7 SASI_Mm01_00258038 predicted 594
8 SASI_Mm01_00258039 predicted 1158
9 SASI_Mm01_00258040 predicted 1394
10 SASI_Mm01_00258041 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440790 predicted 3097
2 SASI_Mm02_00440791 predicted 3019
3 SASI_Mm02_00440792 predicted 11148
4 SASI_Mm02_00440793 predicted 7033
5 SASI_Mm02_00440794 predicted 3191
6 SASI_Mm02_00440795 predicted 6741
7 SASI_Mm02_00440796 predicted 12387
8 SASI_Mm02_00440797 predicted 2703
9 SASI_Mm02_00440798 predicted 10217
10 SASI_Mm02_00440799 predicted 11253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001372
DNAH9 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-9810s1c1
Sequence:CCGGCCGGAGTTCAATCCTGAGTTTCTCGAGAAACTCAGGATTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8325s1c1
Sequence:CCGGCCGAACCTGTATTGTCACTTTCTCGAGAAAGTGACAATACAGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8214s1c1
Sequence:CCGGCGGGATAAGATGGTAGAAGAACTCGAGTTCTTCTACCATCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-4897s1c1
Sequence:CCGGCCGATCTGTTAGACATCCTTTCTCGAGAAAGGATGTCTAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-11250s1c1
Sequence:CCGGGCCAACCTAATAGACAGCATACTCGAGTATGCTGTCTATTAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-5385s1c1
Sequence:CCGGCGGCAGAAGATTATGACTATACTCGAGTATAGTCATAATCTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-3426s21c1
Sequence:CCGGGCCAACCTGGATGCGTTTATACTCGAGTATAAACGCATCCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-11654s21c1
Sequence:CCGGGACCTATGCTTTGCGAGATTTCTCGAGAAATCTCGCAAAGCATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-8192s21c1
Sequence:CCGGGCATGAATCAAATCGAGTTTACTCGAGTAAACTCGATTTGATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001372
DNAH9 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-9810s1c1
Sequence:CCGGCCGGAGTTCAATCCTGAGTTTCTCGAGAAACTCAGGATTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8325s1c1
Sequence:CCGGCCGAACCTGTATTGTCACTTTCTCGAGAAAGTGACAATACAGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8214s1c1
Sequence:CCGGCGGGATAAGATGGTAGAAGAACTCGAGTTCTTCTACCATCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-4897s1c1
Sequence:CCGGCCGATCTGTTAGACATCCTTTCTCGAGAAAGGATGTCTAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-11250s1c1
Sequence:CCGGGCCAACCTAATAGACAGCATACTCGAGTATGCTGTCTATTAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-5385s1c1
Sequence:CCGGCGGCAGAAGATTATGACTATACTCGAGTATAGTCATAATCTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-3426s21c1
Sequence:CCGGGCCAACCTGGATGCGTTTATACTCGAGTATAAACGCATCCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-11654s21c1
Sequence:CCGGGACCTATGCTTTGCGAGATTTCTCGAGAAATCTCGCAAAGCATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-8192s21c1
Sequence:CCGGGCATGAATCAAATCGAGTTTACTCGAGTAAACTCGATTTGATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001372
DNAH9 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-9810s1c1
Sequence:CCGGCCGGAGTTCAATCCTGAGTTTCTCGAGAAACTCAGGATTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8325s1c1
Sequence:CCGGCCGAACCTGTATTGTCACTTTCTCGAGAAAGTGACAATACAGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-8214s1c1
Sequence:CCGGCGGGATAAGATGGTAGAAGAACTCGAGTTCTTCTACCATCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-4897s1c1
Sequence:CCGGCCGATCTGTTAGACATCCTTTCTCGAGAAAGGATGTCTAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-11250s1c1
Sequence:CCGGGCCAACCTAATAGACAGCATACTCGAGTATGCTGTCTATTAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001372.2-5385s1c1
Sequence:CCGGCGGCAGAAGATTATGACTATACTCGAGTATAGTCATAATCTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-3426s21c1
Sequence:CCGGGCCAACCTGGATGCGTTTATACTCGAGTATAAACGCATCCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-11654s21c1
Sequence:CCGGGACCTATGCTTTGCGAGATTTCTCGAGAAATCTCGCAAAGCATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001372.3-8192s21c1
Sequence:CCGGGCATGAATCAAATCGAGTTTACTCGAGTAAACTCGATTTGATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099633
DNAH9 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, heavy chain 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-8203s21c1
Sequence:CCGGCACGAGTCAAGTCGGGTTTATCTCGAGATAAACCCGACTTGACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-11664s21c1
Sequence:CCGGGACCTATGCCATGCGAGATTTCTCGAGAAATCTCGCATGGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-9093s21c1
Sequence:CCGGTGCGGTGAAGCAGTCAATTAGCTCGAGCTAATTGACTGCTTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099633.1-13600s21c1
Sequence:CCGGTGGGTGGTGGGTGATAGATTACTCGAGTAATCTATCACCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-1185s21c1
Sequence:CCGGCATCCAGCAGGCCTCTAATTACTCGAGTAATTAGAGGCCTGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099633
DNAH9 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, heavy chain 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-8203s21c1
Sequence:CCGGCACGAGTCAAGTCGGGTTTATCTCGAGATAAACCCGACTTGACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-11664s21c1
Sequence:CCGGGACCTATGCCATGCGAGATTTCTCGAGAAATCTCGCATGGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-9093s21c1
Sequence:CCGGTGCGGTGAAGCAGTCAATTAGCTCGAGCTAATTGACTGCTTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099633.1-13600s21c1
Sequence:CCGGTGGGTGGTGGGTGATAGATTACTCGAGTAATCTATCACCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-1185s21c1
Sequence:CCGGCATCCAGCAGGCCTCTAATTACTCGAGTAATTAGAGGCCTGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099633
DNAH9 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, heavy chain 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-8203s21c1
Sequence:CCGGCACGAGTCAAGTCGGGTTTATCTCGAGATAAACCCGACTTGACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-11664s21c1
Sequence:CCGGGACCTATGCCATGCGAGATTTCTCGAGAAATCTCGCATGGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-9093s21c1
Sequence:CCGGTGCGGTGAAGCAGTCAATTAGCTCGAGCTAATTGACTGCTTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099633.1-13600s21c1
Sequence:CCGGTGGGTGGTGGGTGATAGATTACTCGAGTAATCTATCACCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099633.1-1185s21c1
Sequence:CCGGCATCCAGCAGGCCTCTAATTACTCGAGTAATTAGAGGCCTGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks