EMAIL THIS PAGE TO A FRIEND

DNAI1

dynein, axonemal, intermediate chain 1

53 Gene Product Result for
Synonyms: CILD1 DIC1 ICS1 PCD
UniProtKB ID: Q9UI46, Q5T8G7, Q8NHQ7, Q9UEZ8
Gene ID:
Human(27019) Summary: The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. This gene encodes an intermediate chain dynein, belonging to the large family of motor proteins. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia (PCD) and Kartagener syndrome. [provided by RefSeq, Jul 2008]
Rat(500442) dynein, axonemal, intermediate chain 1
sheep(101122250) dynein, axonemal, intermediate chain 1
domestic guinea pig(100722355) dynein, axonemal, intermediate chain 1
naked mole-rat(101703186) dynein, axonemal, intermediate chain 1
Zebrafish(570363) dynein, axonemal, intermediate polypeptide 1
chicken(431654) dynein, axonemal, intermediate chain 1
domestic cat(101083042) dynein, axonemal, intermediate chain 1
cow(524709) dynein, axonemal, intermediate chain 1
dog(474749) dynein, axonemal, intermediate chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012144 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121071 MISSION® esiRNA esiRNA human DNAI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012144 Rosetta Predictions human pricing
NM_001024342 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046738 predicted 440
2 SASI_Hs01_00046739 predicted 858
3 SASI_Hs02_00343706 predicted 1778
4 SASI_Hs01_00046741 predicted 455
5 SASI_Hs01_00046742 predicted 754
6 SASI_Hs02_00343707 predicted 1073
7 SASI_Hs01_00046745 predicted 316
8 SASI_Hs01_00046746 predicted 373
9 SASI_Hs01_00046747 predicted 1787
10 SASI_Hs02_00343708 predicted 549
11 SASI_Hs01_00046740 predicted 1916
12 SASI_Hs01_00046743 predicted 467
13 SASI_Hs01_00046744 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033611 predicted 1943
2 SASI_Rn01_00033612 predicted 792
3 SASI_Rn01_00033613 predicted 804
4 SASI_Rn01_00033614 predicted 1796
5 SASI_Rn02_00202571 predicted 1003
6 SASI_Rn01_00033616 predicted 1233
7 SASI_Rn01_00033617 predicted 1180
8 SASI_Rn01_00033618 predicted 2115
9 SASI_Rn01_00033619 predicted 1430
10 SASI_Rn01_00033620 predicted 1621
11 SASI_Rn01_00033615 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012144
DNAI1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, intermediate chain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1078s21c1
Sequence:CCGGTGATGACATTGCTCAAGATTTCTCGAGAAATCTTGAGCAATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-360s21c1
Sequence:CCGGAGTTGACCGATGCGGAGTTAACTCGAGTTAACTCCGCATCGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1053s21c1
Sequence:CCGGAGCGGATGGTCAACCAGAATACTCGAGTATTCTGGTTGACCATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012144.2-2320s1c1
Sequence:CCGGCGCTTGAATACAGTACTCCTACTCGAGTAGGAGTACTGTATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-564s1c1
Sequence:CCGGGCGATGAATTAGTGGCAGGTTCTCGAGAACCTGCCACTAATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-447s1c1
Sequence:CCGGGCTTCAAAGAAGGCACATATACTCGAGTATATGTGCCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1600s1c1
Sequence:CCGGGCTGGTTCACATAGATGTCATCTCGAGATGACATCTATGTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1705s1c1
Sequence:CCGGCCACAAAGAGATTGACTACATCTCGAGATGTAGTCAATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012144
DNAI1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, intermediate chain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1078s21c1
Sequence:CCGGTGATGACATTGCTCAAGATTTCTCGAGAAATCTTGAGCAATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-360s21c1
Sequence:CCGGAGTTGACCGATGCGGAGTTAACTCGAGTTAACTCCGCATCGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1053s21c1
Sequence:CCGGAGCGGATGGTCAACCAGAATACTCGAGTATTCTGGTTGACCATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012144.2-2320s1c1
Sequence:CCGGCGCTTGAATACAGTACTCCTACTCGAGTAGGAGTACTGTATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-564s1c1
Sequence:CCGGGCGATGAATTAGTGGCAGGTTCTCGAGAACCTGCCACTAATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-447s1c1
Sequence:CCGGGCTTCAAAGAAGGCACATATACTCGAGTATATGTGCCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1600s1c1
Sequence:CCGGGCTGGTTCACATAGATGTCATCTCGAGATGACATCTATGTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1705s1c1
Sequence:CCGGCCACAAAGAGATTGACTACATCTCGAGATGTAGTCAATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012144
DNAI1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, intermediate chain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1078s21c1
Sequence:CCGGTGATGACATTGCTCAAGATTTCTCGAGAAATCTTGAGCAATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-360s21c1
Sequence:CCGGAGTTGACCGATGCGGAGTTAACTCGAGTTAACTCCGCATCGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012144.2-1053s21c1
Sequence:CCGGAGCGGATGGTCAACCAGAATACTCGAGTATTCTGGTTGACCATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012144.2-2320s1c1
Sequence:CCGGCGCTTGAATACAGTACTCCTACTCGAGTAGGAGTACTGTATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-564s1c1
Sequence:CCGGGCGATGAATTAGTGGCAGGTTCTCGAGAACCTGCCACTAATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-447s1c1
Sequence:CCGGGCTTCAAAGAAGGCACATATACTCGAGTATATGTGCCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1600s1c1
Sequence:CCGGGCTGGTTCACATAGATGTCATCTCGAGATGACATCTATGTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012144.2-1705s1c1
Sequence:CCGGCCACAAAGAGATTGACTACATCTCGAGATGTAGTCAATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks