EMAIL THIS PAGE TO A FRIEND

DNAI2

dynein, axonemal, intermediate chain 2

72 Gene Product Result for
Synonyms: CILD9 DIC2
UniProtKB ID: Q9GZS0, C9J0S6, Q8IUW4, Q9H179, Q9NT53
Gene ID:
Human(64446) Summary: The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
Rat(360654) dynein, axonemal, intermediate chain 2
chicken(417453) dynein, axonemal, intermediate chain 2
dog(483284) dynein, axonemal, intermediate chain 2
cow(534479) dynein, axonemal, intermediate chain 2
domestic cat(101087691) dynein, axonemal, intermediate chain 2
naked mole-rat(101721426) dynein, axonemal, intermediate chain 2
domestic guinea pig(100725553) dynein, axonemal, intermediate chain 2
sheep(101113084) dynein, axonemal, intermediate chain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023036 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078341 MISSION® esiRNA esiRNA human DNAI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023036 Rosetta Predictions human pricing
NM_001007726 Rosetta Predictions rat pricing
XM_001081642 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169603 predicted 1285
2 SASI_Hs01_00169605 predicted 615
3 SASI_Hs01_00169606 predicted 1178
4 SASI_Hs01_00169607 predicted 1273
5 SASI_Hs02_00356295 predicted 625
6 SASI_Hs01_00169610 predicted 1206
7 SASI_Hs01_00169611 predicted 379
8 SASI_Hs01_00169612 predicted 1056
9 SASI_Hs02_00356296 predicted 386
10 SASI_Hs02_00356297 predicted 843
11 SASI_Hs01_00169604 predicted 1377
12 SASI_Hs01_00169608 predicted 1391
13 SASI_Hs01_00169609 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106397 predicted 1841
2 SASI_Rn01_00106399 predicted 833
3 SASI_Rn01_00106400 predicted 1447
4 SASI_Rn01_00106401 predicted 1694
5 SASI_Rn01_00106402 predicted 738
6 SASI_Rn01_00106403 predicted 1363
7 SASI_Rn01_00106404 predicted 2091
8 SASI_Rn01_00106405 predicted 895
9 SASI_Rn02_00198911 predicted 2102
10 SASI_Rn01_00106406 predicted 1718
11 SASI_Rn01_00106398 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372798 predicted 1838
2 SASI_Rn02_00372799 predicted 1304
3 SASI_Rn02_00372800 predicted 777
4 SASI_Rn02_00372801 predicted 1597
5 SASI_Rn02_00372802 predicted 689
6 SASI_Rn02_00372803 predicted 2090
7 SASI_Rn02_00372804 predicted 1310
8 SASI_Rn02_00372805 predicted 848
9 SASI_Rn02_00372806 predicted 2100
10 SASI_Rn02_00372807 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023036
DNAI2 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, intermediate chain 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023036.1-2275s1c1
Sequence:CCGGCCTACAAATCAGGAACAGAAACTCGAGTTTCTGTTCCTGATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-660s1c1
Sequence:CCGGGCACTGCATCAAGCAGAACAACTCGAGTTGTTCTGCTTGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-661s1c1
Sequence:CCGGCACTGCATCAAGCAGAACAATCTCGAGATTGTTCTGCTTGATGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1771s1c1
Sequence:CCGGCAGAGGAATGAGAAGAACGTACTCGAGTACGTTCTTCTCATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1281s1c1
Sequence:CCGGCGAATCTACTTTGCCCACCAACTCGAGTTGGTGGGCAAAGTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-687s21c1
Sequence:CCGGGGCATGAGCAGCGATTCATACCTCGAGGTATGAATCGCTGCTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-438s21c1
Sequence:CCGGATCATGCAGCTCGGCTCTATCCTCGAGGATAGAGCCGAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-1796s21c1
Sequence:CCGGGAAGGAGGCAGACGCCATAAACTCGAGTTTATGGCGTCTGCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-650s21c1
Sequence:CCGGGGCATACTCCTGCTTGGATTTCTCGAGAAATCCAAGCAGGAGTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023036
DNAI2 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, intermediate chain 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023036.1-2275s1c1
Sequence:CCGGCCTACAAATCAGGAACAGAAACTCGAGTTTCTGTTCCTGATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-660s1c1
Sequence:CCGGGCACTGCATCAAGCAGAACAACTCGAGTTGTTCTGCTTGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-661s1c1
Sequence:CCGGCACTGCATCAAGCAGAACAATCTCGAGATTGTTCTGCTTGATGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1771s1c1
Sequence:CCGGCAGAGGAATGAGAAGAACGTACTCGAGTACGTTCTTCTCATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1281s1c1
Sequence:CCGGCGAATCTACTTTGCCCACCAACTCGAGTTGGTGGGCAAAGTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-687s21c1
Sequence:CCGGGGCATGAGCAGCGATTCATACCTCGAGGTATGAATCGCTGCTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-438s21c1
Sequence:CCGGATCATGCAGCTCGGCTCTATCCTCGAGGATAGAGCCGAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-1796s21c1
Sequence:CCGGGAAGGAGGCAGACGCCATAAACTCGAGTTTATGGCGTCTGCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-650s21c1
Sequence:CCGGGGCATACTCCTGCTTGGATTTCTCGAGAAATCCAAGCAGGAGTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023036
DNAI2 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, intermediate chain 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023036.1-2275s1c1
Sequence:CCGGCCTACAAATCAGGAACAGAAACTCGAGTTTCTGTTCCTGATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-660s1c1
Sequence:CCGGGCACTGCATCAAGCAGAACAACTCGAGTTGTTCTGCTTGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-661s1c1
Sequence:CCGGCACTGCATCAAGCAGAACAATCTCGAGATTGTTCTGCTTGATGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1771s1c1
Sequence:CCGGCAGAGGAATGAGAAGAACGTACTCGAGTACGTTCTTCTCATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023036.1-1281s1c1
Sequence:CCGGCGAATCTACTTTGCCCACCAACTCGAGTTGGTGGGCAAAGTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-687s21c1
Sequence:CCGGGGCATGAGCAGCGATTCATACCTCGAGGTATGAATCGCTGCTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-438s21c1
Sequence:CCGGATCATGCAGCTCGGCTCTATCCTCGAGGATAGAGCCGAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-1796s21c1
Sequence:CCGGGAAGGAGGCAGACGCCATAAACTCGAGTTTATGGCGTCTGCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023036.4-650s21c1
Sequence:CCGGGGCATACTCCTGCTTGGATTTCTCGAGAAATCCAAGCAGGAGTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks