EMAIL THIS PAGE TO A FRIEND

DNAJA1

DnaJ (Hsp40) homolog, subfamily A, member 1

74 Gene Product Result for
Synonyms: DJ-2 DjA1 HDJ2 HSDJ HSJ2 HSPF4 NEDD7 hDJ-2
UniProtKB ID: P31689, Q5T7Q0, Q86TL9
Gene ID:
Mouse(15502) DnaJ (Hsp40) homolog, subfamily A, member 1
Rat(65028) DnaJ (Hsp40) homolog, subfamily A, member 1
chicken(427376) DnaJ (Hsp40) homolog, subfamily A, member 1
dog(100855671) DnaJ (Hsp40) homolog, subfamily A, member 1
domestic cat(101098261) DnaJ (Hsp40) homolog, subfamily A, member 1
cow(528862) DnaJ (Hsp40) homolog, subfamily A, member 1
sheep(101105132) DnaJ (Hsp40) homolog, subfamily A, member 1
domestic guinea pig(100722445) DnaJ (Hsp40) homolog, subfamily A, member 1
naked mole-rat(101720228) DnaJ (Hsp40) homolog, subfamily A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001539 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114481 MISSION® esiRNA esiRNA human DNAJA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001539 Rosetta Predictions human pricing
NM_022934 Rosetta Predictions rat pricing
NM_008298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031818 predicted 1037
2 SASI_Hs02_00332072 predicted 1150
3 SASI_Hs02_00332073 predicted 514
4 SASI_Hs01_00031819 predicted 613
5 SASI_Hs01_00031822 predicted 668
6 SASI_Hs01_00031823 predicted 1075
7 SASI_Hs01_00031824 predicted 1245
8 SASI_Hs01_00031825 predicted 533
9 SASI_Hs01_00031826 predicted 680
10 SASI_Hs01_00031827 predicted 1140
11 SASI_Hs01_00031820 predicted 596
12 SASI_Hs01_00031821 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059695 predicted 984
2 SASI_Rn01_00059696 predicted 1376
3 SASI_Rn01_00059697 predicted 1321
4 SASI_Rn01_00059698 predicted 923
5 SASI_Rn01_00059700 predicted 263
6 SASI_Rn01_00059701 predicted 1306
7 SASI_Rn01_00059702 predicted 459
8 SASI_Rn01_00059703 predicted 1021
9 SASI_Rn01_00059704 predicted 466
10 SASI_Rn02_00263637 predicted 615
11 SASI_Rn01_00059699 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313579 predicted 1189
2 SASI_Mm01_00121531 predicted 973
3 SASI_Mm01_00121533 predicted 495
4 SASI_Mm01_00121534 predicted 254
5 SASI_Mm02_00313580 predicted 912
6 SASI_Mm01_00121536 predicted 895
7 SASI_Mm01_00121537 predicted 1064
8 SASI_Mm01_00121538 predicted 945
9 SASI_Mm01_00121539 predicted 264
10 SASI_Mm02_00313581 predicted 1209
11 SASI_Mm01_00121530 predicted 1303
12 SASI_Mm01_00121532 predicted 1371
13 SASI_Mm01_00121535 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008298
VALIDATED
DNAJA1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1626s21c1
Sequence:CCGGCATATCTTGTGTAACTGATAACTCGAGTTATCAGTTACACAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1684s21c1
Sequence:CCGGTGTATGACCCTTCATTGTTAACTCGAGTTAACAATGAAGGGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1474s1c1
Sequence:CCGGGCCCTGTATGTATGATGACTTCTCGAGAAGTCATCATACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-937s1c1
Sequence:CCGGGCCAATATCTACTCTTGACAACTCGAGTTGTCAAGAGTAGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1229s1c1
Sequence:CCGGCGGCGTCATTATAATGGAGAACTCGAGTTCTCCATTATAATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008298.2-406s1c1
Sequence:CCGGGCAAAGAGAAAGGAGAGGTAACTCGAGTTACCTCTCCTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-211s1c1
Sequence:CCGGCCACCCTGATAAGAATCCAAACTCGAGTTTGGATTCTTATCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008298
VALIDATED
DNAJA1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1626s21c1
Sequence:CCGGCATATCTTGTGTAACTGATAACTCGAGTTATCAGTTACACAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1684s21c1
Sequence:CCGGTGTATGACCCTTCATTGTTAACTCGAGTTAACAATGAAGGGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1474s1c1
Sequence:CCGGGCCCTGTATGTATGATGACTTCTCGAGAAGTCATCATACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-937s1c1
Sequence:CCGGGCCAATATCTACTCTTGACAACTCGAGTTGTCAAGAGTAGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1229s1c1
Sequence:CCGGCGGCGTCATTATAATGGAGAACTCGAGTTCTCCATTATAATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008298.2-406s1c1
Sequence:CCGGGCAAAGAGAAAGGAGAGGTAACTCGAGTTACCTCTCCTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-211s1c1
Sequence:CCGGCCACCCTGATAAGAATCCAAACTCGAGTTTGGATTCTTATCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008298
VALIDATED
DNAJA1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1626s21c1
Sequence:CCGGCATATCTTGTGTAACTGATAACTCGAGTTATCAGTTACACAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008298.5-1684s21c1
Sequence:CCGGTGTATGACCCTTCATTGTTAACTCGAGTTAACAATGAAGGGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1474s1c1
Sequence:CCGGGCCCTGTATGTATGATGACTTCTCGAGAAGTCATCATACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-937s1c1
Sequence:CCGGGCCAATATCTACTCTTGACAACTCGAGTTGTCAAGAGTAGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-1229s1c1
Sequence:CCGGCGGCGTCATTATAATGGAGAACTCGAGTTCTCCATTATAATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008298.2-406s1c1
Sequence:CCGGGCAAAGAGAAAGGAGAGGTAACTCGAGTTACCTCTCCTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008298.2-211s1c1
Sequence:CCGGCCACCCTGATAAGAATCCAAACTCGAGTTTGGATTCTTATCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001539
VALIDATED
DNAJA1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1136s21c1
Sequence:CCGGGTCGCCTAATCATCGAATTTACTCGAGTAAATTCGATGATTAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001539.2-1321s21c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1078s21c1
Sequence:CCGGGATATCAAGTGTGTACTAAATCTCGAGATTTAGTACACACTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1260s21c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-1159s1c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-953s1c1
Sequence:CCGGCCAGGTCAGATTGTCAAGCATCTCGAGATGCTTGACAATCTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-1142s1c1
Sequence:CCGGGAGACTGATGAGATGGACCAACTCGAGTTGGTCCATCTCATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-170s1c1
Sequence:CCGGGCCTTGAAGTACCATCCTGATCTCGAGATCAGGATGGTACTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1220s1c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1006s1c1
Sequence:CCGGGCCAATTTATCGTAGACCATACTCGAGTATGGTCTACGATAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-673s1c1
Sequence:CCGGCGGAAGGAAGATAGTTCGAGACTCGAGTCTCGAACTATCTTCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001539
VALIDATED
DNAJA1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1136s21c1
Sequence:CCGGGTCGCCTAATCATCGAATTTACTCGAGTAAATTCGATGATTAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001539.2-1321s21c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1078s21c1
Sequence:CCGGGATATCAAGTGTGTACTAAATCTCGAGATTTAGTACACACTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1260s21c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-1159s1c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-953s1c1
Sequence:CCGGCCAGGTCAGATTGTCAAGCATCTCGAGATGCTTGACAATCTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-1142s1c1
Sequence:CCGGGAGACTGATGAGATGGACCAACTCGAGTTGGTCCATCTCATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-170s1c1
Sequence:CCGGGCCTTGAAGTACCATCCTGATCTCGAGATCAGGATGGTACTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1220s1c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1006s1c1
Sequence:CCGGGCCAATTTATCGTAGACCATACTCGAGTATGGTCTACGATAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-673s1c1
Sequence:CCGGCGGAAGGAAGATAGTTCGAGACTCGAGTCTCGAACTATCTTCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001539
VALIDATED
DNAJA1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1136s21c1
Sequence:CCGGGTCGCCTAATCATCGAATTTACTCGAGTAAATTCGATGATTAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001539.2-1321s21c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1078s21c1
Sequence:CCGGGATATCAAGTGTGTACTAAATCTCGAGATTTAGTACACACTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001539.2-1260s21c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-1159s1c1
Sequence:CCGGCCAAGTAGAACTGGTGGACTTCTCGAGAAGTCCACCAGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001539.1-953s1c1
Sequence:CCGGCCAGGTCAGATTGTCAAGCATCTCGAGATGCTTGACAATCTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-1142s1c1
Sequence:CCGGGAGACTGATGAGATGGACCAACTCGAGTTGGTCCATCTCATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-170s1c1
Sequence:CCGGGCCTTGAAGTACCATCCTGATCTCGAGATCAGGATGGTACTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1220s1c1
Sequence:CCGGGCATATGAGGATGATGAACATCTCGAGATGTTCATCATCCTCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001539.1-1006s1c1
Sequence:CCGGGCCAATTTATCGTAGACCATACTCGAGTATGGTCTACGATAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001539.1-673s1c1
Sequence:CCGGCGGAAGGAAGATAGTTCGAGACTCGAGTCTCGAACTATCTTCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks