EMAIL THIS PAGE TO A FRIEND

DNAJA2

DnaJ (Hsp40) homolog, subfamily A, member 2

112 Gene Product Result for
Synonyms: CPR3 DJ3 DJA2 DNAJ DNJ3 HIRIP4 PRO3015 RDJ2
UniProtKB ID: O60884, B2R7L7, O14711
Gene ID:
Human(10294) Summary: The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]
Mouse(56445) DnaJ (Hsp40) homolog, subfamily A, member 2
Rat(84026) DnaJ (Hsp40) homolog, subfamily A, member 2
Zebrafish(406814) DnaJ (Hsp40) homolog, subfamily A, member 2
dog(478143) DnaJ (Hsp40) homolog, subfamily A, member 2
cow(360006) DnaJ (Hsp40) homolog, subfamily A, member 2
domestic cat(101092976) DnaJ (Hsp40) homolog, subfamily A, member 2
chicken(415744) DnaJ (Hsp40) homolog, subfamily A, member 2
sheep(101114549) DnaJ (Hsp40) homolog, subfamily A, member 2
naked mole-rat(101699482) DnaJ (Hsp40) homolog, subfamily A, member 2
domestic guinea pig(100721607) DnaJ (Hsp40) homolog, subfamily A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005880 Rosetta Predictions human pricing
NM_032079 Rosetta Predictions rat pricing
NM_019794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066067 predicted 893
2 SASI_Hs01_00066068 predicted 928
3 SASI_Hs01_00066069 predicted 1304
4 SASI_Hs02_00340469 predicted 1218
5 SASI_Hs02_00340470 predicted 1465
6 SASI_Hs01_00066072 predicted 1167
7 SASI_Hs01_00066073 predicted 308
8 SASI_Hs01_00066074 predicted 486
9 SASI_Hs01_00066076 predicted 488
10 SASI_Hs01_00066070 predicted 1433
11 SASI_Hs01_00066071 predicted 501
12 SASI_Hs01_00066075 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073575 predicted 967
2 SASI_Rn01_00073577 predicted 893
3 SASI_Rn01_00073578 predicted 828
4 SASI_Rn01_00073580 predicted 1182
5 SASI_Rn01_00073581 predicted 315
6 SASI_Rn01_00073583 predicted 369
7 SASI_Rn02_00265455 predicted 661
8 SASI_Rn02_00265456 predicted 657
9 SASI_Rn01_00073576 predicted 859
10 SASI_Rn01_00073579 predicted 1117
11 SASI_Rn01_00073582 predicted 700
12 SASI_Rn01_00073584 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127823 predicted 357
2 SASI_Mm01_00127824 predicted 999
3 SASI_Mm02_00325016 predicted 834
4 SASI_Mm02_00325017 predicted 310
5 SASI_Mm02_00325018 predicted 1192
6 SASI_Mm01_00127829 predicted 212
7 SASI_Mm01_00127830 predicted 695
8 SASI_Mm01_00127831 predicted 1345
9 SASI_Mm02_00325019 predicted 1354
10 SASI_Mm02_00325020 predicted 320
11 SASI_Mm01_00127822 predicted 987
12 SASI_Mm01_00127825 predicted 852
13 SASI_Mm01_00127826 predicted 824
14 SASI_Mm01_00127827 predicted 652
15 SASI_Mm01_00127828 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019794
VALIDATED
DNAJA2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-1671s1c1
Sequence:CCGGGCCTGTATCTATCATTTAGATCTCGAGATCTAAATGATAGATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-212s1c1
Sequence:CCGGCGAGAGCTGTATGACAGATATCTCGAGATATCTGTCATACAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-977s1c1
Sequence:CCGGCCACAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-896s1c1
Sequence:CCGGGCTCGTCAGATTGTGGTGAAACTCGAGTTTCACCACAATCTGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019794.1-119s1c1
Sequence:CCGGGCCAAAGAATACCACCCTGATCTCGAGATCAGGGTGGTATTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019794
VALIDATED
DNAJA2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-1671s1c1
Sequence:CCGGGCCTGTATCTATCATTTAGATCTCGAGATCTAAATGATAGATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-212s1c1
Sequence:CCGGCGAGAGCTGTATGACAGATATCTCGAGATATCTGTCATACAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-977s1c1
Sequence:CCGGCCACAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-896s1c1
Sequence:CCGGGCTCGTCAGATTGTGGTGAAACTCGAGTTTCACCACAATCTGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019794.1-119s1c1
Sequence:CCGGGCCAAAGAATACCACCCTGATCTCGAGATCAGGGTGGTATTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019794
VALIDATED
DNAJA2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-1671s1c1
Sequence:CCGGGCCTGTATCTATCATTTAGATCTCGAGATCTAAATGATAGATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-212s1c1
Sequence:CCGGCGAGAGCTGTATGACAGATATCTCGAGATATCTGTCATACAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-977s1c1
Sequence:CCGGCCACAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019794.1-896s1c1
Sequence:CCGGGCTCGTCAGATTGTGGTGAAACTCGAGTTTCACCACAATCTGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019794.1-119s1c1
Sequence:CCGGGCCAAAGAATACCACCCTGATCTCGAGATCAGGGTGGTATTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005880
VALIDATED
DNAJA2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1220s1c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-1004s1c1
Sequence:CCGGCCGCAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1335s1c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-407s1c1
Sequence:CCGGCCACTCAAAGTATCTTTAGAACTCGAGTTCTAAAGATACTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-238s1c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-328s21c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1310s21c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1425s21c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1215s21c1
Sequence:CCGGGACCGGAAGTTCCTAACATAACTCGAGTTATGTTAGGAACTTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-937s21c1
Sequence:CCGGTGATTTGCACATGACATATAACTCGAGTTATATGTCATGTGCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005880
VALIDATED
DNAJA2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1220s1c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-1004s1c1
Sequence:CCGGCCGCAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1335s1c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-407s1c1
Sequence:CCGGCCACTCAAAGTATCTTTAGAACTCGAGTTCTAAAGATACTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-238s1c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-328s21c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1310s21c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1425s21c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1215s21c1
Sequence:CCGGGACCGGAAGTTCCTAACATAACTCGAGTTATGTTAGGAACTTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-937s21c1
Sequence:CCGGTGATTTGCACATGACATATAACTCGAGTTATATGTCATGTGCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005880
VALIDATED
DNAJA2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1220s1c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-1004s1c1
Sequence:CCGGCCGCAGTATCGTAATCCCTTTCTCGAGAAAGGGATTACGATACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-1335s1c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005880.2-407s1c1
Sequence:CCGGCCACTCAAAGTATCTTTAGAACTCGAGTTCTAAAGATACTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005880.2-238s1c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-328s21c1
Sequence:CCGGGCGTGAGTTATATGACAGATACTCGAGTATCTGTCATATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1310s21c1
Sequence:CCGGGCCTATAATGATAGCTCTGATCTCGAGATCAGAGCTATCATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1425s21c1
Sequence:CCGGGCCTGATTTGTTCTCAGCAATCTCGAGATTGCTGAGAACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-1215s21c1
Sequence:CCGGGACCGGAAGTTCCTAACATAACTCGAGTTATGTTAGGAACTTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005880.3-937s21c1
Sequence:CCGGTGATTTGCACATGACATATAACTCGAGTTATATGTCATGTGCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks