EMAIL THIS PAGE TO A FRIEND

DNAJA3

DnaJ (Hsp40) homolog, subfamily A, member 3

74 Gene Product Result for
Synonyms: HCA57 TID1 hTID-1
Gene ID:
Human(9093) Summary: This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(83945) DnaJ (Hsp40) homolog, subfamily A, member 3
Rat(360481) DnaJ (Hsp40) homolog, subfamily A, member 3
chicken(416671) DnaJ (Hsp40) homolog, subfamily A, member 3
cow(513397) DnaJ (Hsp40) homolog, subfamily A, member 3
Horse(100066092) DnaJ (Hsp40) homolog, subfamily A, member 3
domestic cat(101094070) DnaJ (Hsp40) homolog, subfamily A, member 3
dog(479865) DnaJ (Hsp40) homolog, subfamily A, member 3
domestic guinea pig(100719173) DnaJ (Hsp40) homolog, subfamily A, member 3
naked mole-rat(101720637) DnaJ (Hsp40) homolog, subfamily A, member 3
sheep(101123174) DnaJ (Hsp40) homolog, subfamily A, member 3
Domestic Rabbit(100338697) DnaJ (Hsp40) homolog, subfamily A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091601 MISSION® esiRNA esiRNA human DNAJA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005147 Rosetta Predictions human pricing
NM_001038595 Rosetta Predictions rat pricing
NM_001038596 Rosetta Predictions rat pricing
NM_023646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211349 predicted 1434
2 SASI_Hs02_00339082 predicted 603
3 SASI_Hs01_00211350 predicted 298
4 SASI_Hs01_00211351 predicted 1178
5 SASI_Hs01_00211352 predicted 345
6 SASI_Hs01_00211353 predicted 282
7 SASI_Hs01_00211354 predicted 326
8 SASI_Hs01_00211355 predicted 1242
9 SASI_Hs01_00211356 predicted 557
10 SASI_Hs01_00211357 predicted 216
11 SASI_Hs01_00211358 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204685 predicted 257
2 SASI_Rn01_00061452 predicted 348
3 SASI_Rn02_00204686 predicted 883
4 SASI_Rn01_00061454 predicted 737
5 SASI_Rn01_00061455 predicted 886
6 SASI_Rn01_00061456 predicted 591
7 SASI_Rn01_00061457 predicted 328
8 SASI_Rn01_00061458 predicted 622
9 SASI_Rn01_00061459 predicted 600
10 SASI_Rn01_00061460 predicted 807
11 SASI_Rn01_00061453 predicted 555
12 SASI_Rn01_00061461 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204687 predicted 256
2 SASI_Rn01_00108396 predicted 352
3 SASI_Rn02_00204688 predicted 879
4 SASI_Rn01_00108398 predicted 736
5 SASI_Rn01_00108399 predicted 885
6 SASI_Rn01_00108400 predicted 593
7 SASI_Rn01_00108401 predicted 320
8 SASI_Rn01_00108402 predicted 625
9 SASI_Rn01_00108403 predicted 596
10 SASI_Rn01_00108404 predicted 808
11 SASI_Rn01_00108397 predicted 556
12 SASI_Rn01_00108405 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192748 predicted 432
2 SASI_Mm01_00192749 predicted 1192
3 SASI_Mm01_00192750 predicted 987
4 SASI_Mm01_00192751 predicted 465
5 SASI_Mm01_00192752 predicted 753
6 SASI_Mm01_00192753 predicted 685
7 SASI_Mm01_00192754 predicted 1162
8 SASI_Mm01_00192755 predicted 607
9 SASI_Mm01_00192756 predicted 621
10 SASI_Mm01_00192757 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005147
VALIDATED
DNAJA3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1067s21c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1852s21c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-314s21c1
Sequence:CCGGATATTAGGAGTGCCTCGAAATCTCGAGATTTCGAGGCACTCCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-597s21c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1828s1c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1043s1c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-573s1c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1183s1c1
Sequence:CCGGCCGGATTAACAGCTACGGCTACTCGAGTAGCCGTAGCTGTTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005147
VALIDATED
DNAJA3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1067s21c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1852s21c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-314s21c1
Sequence:CCGGATATTAGGAGTGCCTCGAAATCTCGAGATTTCGAGGCACTCCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-597s21c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1828s1c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1043s1c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-573s1c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1183s1c1
Sequence:CCGGCCGGATTAACAGCTACGGCTACTCGAGTAGCCGTAGCTGTTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005147
VALIDATED
DNAJA3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1067s21c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-1852s21c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-314s21c1
Sequence:CCGGATATTAGGAGTGCCTCGAAATCTCGAGATTTCGAGGCACTCCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005147.4-597s21c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1828s1c1
Sequence:CCGGGCATCAAGTTACGAAGTGATTCTCGAGAATCACTTCGTAACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1043s1c1
Sequence:CCGGTCCGACCTCTTTATTTCTATACTCGAGTATAGAAATAAAGAGGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-573s1c1
Sequence:CCGGGCGAGTTCTCATCCTCTTCATCTCGAGATGAAGAGGATGAGAACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005147.3-1183s1c1
Sequence:CCGGCCGGATTAACAGCTACGGCTACTCGAGTAGCCGTAGCTGTTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023646
VALIDATED
DNAJA3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-615s21c1
Sequence:CCGGAGTTGTTCAGGAAGATCTTTGCTCGAGCAAAGATCTTCCTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-449s21c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023646.4-1525s21c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-328s21c1
Sequence:CCGGTTTGGCCAAAGATGATTATTACTCGAGTAATAATCATCTTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023646.4-386s21c1
Sequence:CCGGGATATCAAGAAAGCCTATTATCTCGAGATAATAGGCTTTCTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-1475s1c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-636s1c1
Sequence:CCGGCCTCAGGAATACATCATGGAACTCGAGTTCCATGATGTATTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-399s1c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-1196s1c1
Sequence:CCGGCCGGATTAATAGCTATGGCTACTCGAGTAGCCATAGCTATTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-790s1c1
Sequence:CCGGCGGGCATGGAAACTATCAATACTCGAGTATTGATAGTTTCCATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023646
VALIDATED
DNAJA3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-615s21c1
Sequence:CCGGAGTTGTTCAGGAAGATCTTTGCTCGAGCAAAGATCTTCCTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-449s21c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023646.4-1525s21c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-328s21c1
Sequence:CCGGTTTGGCCAAAGATGATTATTACTCGAGTAATAATCATCTTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023646.4-386s21c1
Sequence:CCGGGATATCAAGAAAGCCTATTATCTCGAGATAATAGGCTTTCTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-1475s1c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-636s1c1
Sequence:CCGGCCTCAGGAATACATCATGGAACTCGAGTTCCATGATGTATTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-399s1c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-1196s1c1
Sequence:CCGGCCGGATTAATAGCTATGGCTACTCGAGTAGCCATAGCTATTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-790s1c1
Sequence:CCGGCGGGCATGGAAACTATCAATACTCGAGTATTGATAGTTTCCATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023646
VALIDATED
DNAJA3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-615s21c1
Sequence:CCGGAGTTGTTCAGGAAGATCTTTGCTCGAGCAAAGATCTTCCTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-449s21c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023646.4-1525s21c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023646.4-328s21c1
Sequence:CCGGTTTGGCCAAAGATGATTATTACTCGAGTAATAATCATCTTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023646.4-386s21c1
Sequence:CCGGGATATCAAGAAAGCCTATTATCTCGAGATAATAGGCTTTCTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-1475s1c1
Sequence:CCGGGCGGTCAACTGGAAACTAAATCTCGAGATTTAGTTTCCAGTTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-636s1c1
Sequence:CCGGCCTCAGGAATACATCATGGAACTCGAGTTCCATGATGTATTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023646.2-399s1c1
Sequence:CCGGCCCAAAGCCAAGGAGAAGTTTCTCGAGAAACTTCTCCTTGGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-1196s1c1
Sequence:CCGGCCGGATTAATAGCTATGGCTACTCGAGTAGCCATAGCTATTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023646.2-790s1c1
Sequence:CCGGCGGGCATGGAAACTATCAATACTCGAGTATTGATAGTTTCCATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks