EMAIL THIS PAGE TO A FRIEND

DNAJA4

DnaJ (Hsp40) homolog, subfamily A, member 4

86 Gene Product Result for
Synonyms: MST104 MSTP104 PRO1472
UniProtKB ID: Q8WW22, E9PDM9, Q6AW87, Q8N5Z4, Q8N7P2
Gene ID:
Mouse(58233) DnaJ (Hsp40) homolog, subfamily A, member 4
Rat(300721) DnaJ (Hsp40) homolog, subfamily A, member 4
chicken(415360) DnaJ (Hsp40) homolog, subfamily A, member 4
dog(488777) DnaJ (Hsp40) homolog, subfamily A, member 4
cow(528615) DnaJ (Hsp40) homolog, subfamily A, member 4
domestic cat(101091198) DnaJ (Hsp40) homolog, subfamily A, member 4
sheep(101121551) DnaJ (Hsp40) homolog, subfamily A, member 4
naked mole-rat(101705297) DnaJ (Hsp40) homolog, subfamily A, member 4
domestic guinea pig(100729875) DnaJ (Hsp40) homolog, subfamily A, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018602 Rosetta Predictions human pricing
NM_001025411 Rosetta Predictions rat pricing
NM_021422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114766 predicted 1198
2 SASI_Hs01_00114767 predicted 579
3 SASI_Hs01_00114768 predicted 1156
4 SASI_Hs01_00114769 predicted 1301
5 SASI_Hs01_00114770 predicted 554
6 SASI_Hs01_00114771 predicted 389
7 SASI_Hs01_00114772 predicted 1480
8 SASI_Hs01_00114774 predicted 1510
9 SASI_Hs02_00352128 predicted 545
10 SASI_Hs02_00352129 predicted 507
11 SASI_Hs01_00114773 predicted 618
12 SASI_Hs01_00114775 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087242 predicted 692
2 SASI_Rn01_00087243 predicted 848
3 SASI_Rn01_00087244 predicted 1365
4 SASI_Rn01_00087245 predicted 863
5 SASI_Rn01_00087246 predicted 895
6 SASI_Rn01_00087248 predicted 886
7 SASI_Rn01_00087249 predicted 916
8 SASI_Rn01_00087250 predicted 1188
9 SASI_Rn02_00203145 predicted 1520
10 SASI_Rn01_00087251 predicted 701
11 SASI_Rn01_00087247 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063145 predicted 325
2 SASI_Mm01_00063146 predicted 1429
3 SASI_Mm01_00063147 predicted 317
4 SASI_Mm01_00063150 predicted 1410
5 SASI_Mm01_00063152 predicted 1016
6 SASI_Mm01_00063153 predicted 482
7 SASI_Mm01_00063154 predicted 537
8 SASI_Mm02_00326059 predicted 815
9 SASI_Mm02_00326060 predicted 1030
10 SASI_Mm02_00326061 predicted 973
11 SASI_Mm01_00063148 predicted 1229
12 SASI_Mm01_00063149 predicted 529
13 SASI_Mm01_00063151 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018602
DNAJA4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-372s1c1
Sequence:CCGGGCGAGAAGTTTAAACTCATATCTCGAGATATGAGTTTAAACTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-1292s1c1
Sequence:CCGGCCTCGACAGAAAGTGAGGATTCTCGAGAATCCTCACTTTCTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-983s1c1
Sequence:CCGGCAGAAGGATCATAGTGTCTTTCTCGAGAAAGACACTATGATCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-863s21c1
Sequence:CCGGATCCGTGAGAAGAAGATTATCCTCGAGGATAATCTTCTTCTCACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-454s21c1
Sequence:CCGGAGGCGGAGAGCAGGCAATTAACTCGAGTTAATTGCCTGCTCTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-1126s21c1
Sequence:CCGGCAAAGCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018602
DNAJA4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-372s1c1
Sequence:CCGGGCGAGAAGTTTAAACTCATATCTCGAGATATGAGTTTAAACTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-1292s1c1
Sequence:CCGGCCTCGACAGAAAGTGAGGATTCTCGAGAATCCTCACTTTCTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-983s1c1
Sequence:CCGGCAGAAGGATCATAGTGTCTTTCTCGAGAAAGACACTATGATCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-863s21c1
Sequence:CCGGATCCGTGAGAAGAAGATTATCCTCGAGGATAATCTTCTTCTCACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-454s21c1
Sequence:CCGGAGGCGGAGAGCAGGCAATTAACTCGAGTTAATTGCCTGCTCTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-1126s21c1
Sequence:CCGGCAAAGCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018602
DNAJA4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-372s1c1
Sequence:CCGGGCGAGAAGTTTAAACTCATATCTCGAGATATGAGTTTAAACTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-1292s1c1
Sequence:CCGGCCTCGACAGAAAGTGAGGATTCTCGAGAATCCTCACTTTCTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018602.2-983s1c1
Sequence:CCGGCAGAAGGATCATAGTGTCTTTCTCGAGAAAGACACTATGATCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-863s21c1
Sequence:CCGGATCCGTGAGAAGAAGATTATCCTCGAGGATAATCTTCTTCTCACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-454s21c1
Sequence:CCGGAGGCGGAGAGCAGGCAATTAACTCGAGTTAATTGCCTGCTCTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018602.3-1126s21c1
Sequence:CCGGCAAAGCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021422
VALIDATED
DNAJA4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily A, member 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021422.2-1439s1c1
Sequence:CCGGCGCTTTAATAGCCTCACGTTTCTCGAGAAACGTGAGGCTATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-886s1c1
Sequence:CCGGGATGTGATAATTGTGCTTGATCTCGAGATCAAGCACAATTATCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-461s1c1
Sequence:CCGGGACGGATGACTAGAGAGAGAACTCGAGTTCTCTCTCTAGTCATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021422.2-987s1c1
Sequence:CCGGTGGCTTCAAGAAGACAATAAACTCGAGTTTATTGTCTTCTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-317s1c1
Sequence:CCGGCCCAGGCATATGAAGTACTTTCTCGAGAAAGTACTTCATATGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-510s21c1
Sequence:CCGGGTAACTCTGGAAGACTTATATCTCGAGATATAAGTCTTCCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-1040s21c1
Sequence:CCGGTAAGTCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021422
VALIDATED
DNAJA4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily A, member 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021422.2-1439s1c1
Sequence:CCGGCGCTTTAATAGCCTCACGTTTCTCGAGAAACGTGAGGCTATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-886s1c1
Sequence:CCGGGATGTGATAATTGTGCTTGATCTCGAGATCAAGCACAATTATCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-461s1c1
Sequence:CCGGGACGGATGACTAGAGAGAGAACTCGAGTTCTCTCTCTAGTCATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021422.2-987s1c1
Sequence:CCGGTGGCTTCAAGAAGACAATAAACTCGAGTTTATTGTCTTCTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-317s1c1
Sequence:CCGGCCCAGGCATATGAAGTACTTTCTCGAGAAAGTACTTCATATGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-510s21c1
Sequence:CCGGGTAACTCTGGAAGACTTATATCTCGAGATATAAGTCTTCCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-1040s21c1
Sequence:CCGGTAAGTCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021422
VALIDATED
DNAJA4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily A, member 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021422.2-1439s1c1
Sequence:CCGGCGCTTTAATAGCCTCACGTTTCTCGAGAAACGTGAGGCTATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-886s1c1
Sequence:CCGGGATGTGATAATTGTGCTTGATCTCGAGATCAAGCACAATTATCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-461s1c1
Sequence:CCGGGACGGATGACTAGAGAGAGAACTCGAGTTCTCTCTCTAGTCATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021422.2-987s1c1
Sequence:CCGGTGGCTTCAAGAAGACAATAAACTCGAGTTTATTGTCTTCTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021422.2-317s1c1
Sequence:CCGGCCCAGGCATATGAAGTACTTTCTCGAGAAAGTACTTCATATGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-510s21c1
Sequence:CCGGGTAACTCTGGAAGACTTATATCTCGAGATATAAGTCTTCCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021422.3-1040s21c1
Sequence:CCGGTAAGTCAGGTGAGGTGATAAACTCGAGTTTATCACCTCACCTGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks