EMAIL THIS PAGE TO A FRIEND

DNAJB11

DnaJ (Hsp40) homolog, subfamily B, member 11

Synonyms: ABBP-2 ABBP2 DJ9 Dj-9 EDJ ERdj3 ERj3 ERj3p PRO1080 UNQ537 hDj-9
UniProtKB ID: Q9UBS4, Q542Y5, Q542Y9, Q6IAQ8, Q96JC6
Gene ID:
Human(51726) Summary: DNAJB11 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a C-terminal cysteine-rich region (Ohtsuka and Hata, 2000 [PubMed 11147971]
Mouse(67838) DnaJ (Hsp40) homolog, subfamily B, member 11
Rat(360734) DnaJ (Hsp40) homolog, subfamily B, member 11
Zebrafish(386709) DnaJ (Hsp40) homolog, subfamily B, member 11
chicken(424868) DnaJ (Hsp40) homolog, subfamily B, member 11
domestic cat(101100077) DnaJ (Hsp40) homolog, subfamily B, member 11
Horse(100059460) DnaJ (Hsp40) homolog, subfamily B, member 11
cow(506316) DnaJ (Hsp40) homolog, subfamily B, member 11
dog(478664) DnaJ (Hsp40) homolog, subfamily B, member 11
sheep(101113897) DnaJ (Hsp40) homolog, subfamily B, member 11
Domestic Rabbit(100343826) DnaJ (Hsp40) homolog, subfamily B, member 11
naked mole-rat(101724347) DnaJ (Hsp40) homolog, subfamily B, member 11
domestic guinea pig(100729203) DnaJ (Hsp40) homolog, subfamily B, member 11
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016306 Rosetta Predictions human pricing
NM_001015021 Rosetta Predictions rat pricing
NM_026400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050785 predicted 468
2 SASI_Hs01_00050786 predicted 929
3 SASI_Hs01_00050787 predicted 1066
4 SASI_Hs01_00050788 predicted 326
5 SASI_Hs01_00050790 predicted 802
6 SASI_Hs02_00349233 predicted 722
7 SASI_Hs01_00050792 predicted 1075
8 SASI_Hs01_00050793 predicted 473
9 SASI_Hs02_00349234 predicted 1135
10 SASI_Hs01_00050794 predicted 466
11 SASI_Hs01_00050789 predicted 617
12 SASI_Hs01_00050791 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202069 predicted 768
2 SASI_Rn02_00202070 predicted 1341
3 SASI_Rn02_00202071 predicted 794
4 SASI_Rn02_00202072 predicted 613
5 SASI_Rn02_00202073 predicted 886
6 SASI_Rn02_00202074 predicted 780
7 SASI_Rn02_00202075 predicted 1183
8 SASI_Rn02_00202076 predicted 395
9 SASI_Rn02_00202077 predicted 565
10 SASI_Rn02_00202078 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117623 predicted 562
2 SASI_Mm02_00330177 predicted 596
3 SASI_Mm02_00330178 predicted 897
4 SASI_Mm02_00330179 predicted 1025
5 SASI_Mm02_00330180 predicted 1118
6 SASI_Mm01_00117626 predicted 1240
7 SASI_Mm02_00330181 predicted 1019
8 SASI_Mm02_00330182 predicted 230
9 SASI_Mm02_00330183 predicted 1278
10 SASI_Mm02_00330184 predicted 1181
11 SASI_Mm01_00117621 predicted 1065
12 SASI_Mm01_00117622 predicted 339
13 SASI_Mm01_00117624 predicted 743
14 SASI_Mm01_00117625 predicted 830
15 SASI_Mm01_00117627 predicted 716
16 SASI_Mm01_00117628 predicted 1295
17 SASI_Mm01_00117629 predicted 1140
18 SASI_Mm01_00117630 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026400
VALIDATED
DNAJB11 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 11
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-712s1c1
Sequence:CCGGCCCTAATGTCAAATTAGTGAACTCGAGTTCACTAATTTGACATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1039s1c1
Sequence:CCGGGCTGCCCAACTTTGATAACAACTCGAGTTGTTATCAAAGTTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026400.2-190s1c1
Sequence:CCGGCGGGCGAGATTTCTATAAGATCTCGAGATCTTATAGAAATCTCGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1331s1c1
Sequence:CCGGCCTGACAAGAACTAGAGGTTTCTCGAGAAACCTCTAGTTCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-844s1c1
Sequence:CCGGGTTCCGAATCAAAGTTGTCAACTCGAGTTGACAACTTTGATTCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-757s21c1
Sequence:CCGGACGAGTGCCCTAATGTCAAATCTCGAGATTTGACATTAGGGCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-1018s21c1
Sequence:CCGGATGGTCACAAGGTCCATATTTCTCGAGAAATATGGACCTTGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-909s21c1
Sequence:CCGGGTTGTCAAGCACCGGATATTTCTCGAGAAATATCCGGTGCTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-273s21c1
Sequence:CCGGCCTCGAAGTGCCTCCATAAAGCTCGAGCTTTATGGAGGCACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1271s21c1
Sequence:CCGGCTTTGAAAGAGGCCACATAATCTCGAGATTATGTGGCCTCTTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026400.4-539s21c1
Sequence:CCGGTCGTCAGCAGGACAGGAATATCTCGAGATATTCCTGTCCTGCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-661s21c1
Sequence:CCGGAGGCTCCTGGCAAACGGAAATCTCGAGATTTCCGTTTGCCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1502s21c1
Sequence:CCGGCTCAGCACCTCTGCAACATTTCTCGAGAAATGTTGCAGAGGTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026400
VALIDATED
DNAJB11 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 11
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-712s1c1
Sequence:CCGGCCCTAATGTCAAATTAGTGAACTCGAGTTCACTAATTTGACATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1039s1c1
Sequence:CCGGGCTGCCCAACTTTGATAACAACTCGAGTTGTTATCAAAGTTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026400.2-190s1c1
Sequence:CCGGCGGGCGAGATTTCTATAAGATCTCGAGATCTTATAGAAATCTCGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1331s1c1
Sequence:CCGGCCTGACAAGAACTAGAGGTTTCTCGAGAAACCTCTAGTTCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-844s1c1
Sequence:CCGGGTTCCGAATCAAAGTTGTCAACTCGAGTTGACAACTTTGATTCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-757s21c1
Sequence:CCGGACGAGTGCCCTAATGTCAAATCTCGAGATTTGACATTAGGGCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-1018s21c1
Sequence:CCGGATGGTCACAAGGTCCATATTTCTCGAGAAATATGGACCTTGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-909s21c1
Sequence:CCGGGTTGTCAAGCACCGGATATTTCTCGAGAAATATCCGGTGCTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-273s21c1
Sequence:CCGGCCTCGAAGTGCCTCCATAAAGCTCGAGCTTTATGGAGGCACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1271s21c1
Sequence:CCGGCTTTGAAAGAGGCCACATAATCTCGAGATTATGTGGCCTCTTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026400.4-539s21c1
Sequence:CCGGTCGTCAGCAGGACAGGAATATCTCGAGATATTCCTGTCCTGCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-661s21c1
Sequence:CCGGAGGCTCCTGGCAAACGGAAATCTCGAGATTTCCGTTTGCCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1502s21c1
Sequence:CCGGCTCAGCACCTCTGCAACATTTCTCGAGAAATGTTGCAGAGGTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026400
VALIDATED
DNAJB11 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 11
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-712s1c1
Sequence:CCGGCCCTAATGTCAAATTAGTGAACTCGAGTTCACTAATTTGACATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1039s1c1
Sequence:CCGGGCTGCCCAACTTTGATAACAACTCGAGTTGTTATCAAAGTTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026400.2-190s1c1
Sequence:CCGGCGGGCGAGATTTCTATAAGATCTCGAGATCTTATAGAAATCTCGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-1331s1c1
Sequence:CCGGCCTGACAAGAACTAGAGGTTTCTCGAGAAACCTCTAGTTCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026400.2-844s1c1
Sequence:CCGGGTTCCGAATCAAAGTTGTCAACTCGAGTTGACAACTTTGATTCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-757s21c1
Sequence:CCGGACGAGTGCCCTAATGTCAAATCTCGAGATTTGACATTAGGGCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-1018s21c1
Sequence:CCGGATGGTCACAAGGTCCATATTTCTCGAGAAATATGGACCTTGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-909s21c1
Sequence:CCGGGTTGTCAAGCACCGGATATTTCTCGAGAAATATCCGGTGCTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-273s21c1
Sequence:CCGGCCTCGAAGTGCCTCCATAAAGCTCGAGCTTTATGGAGGCACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1271s21c1
Sequence:CCGGCTTTGAAAGAGGCCACATAATCTCGAGATTATGTGGCCTCTTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026400.4-539s21c1
Sequence:CCGGTCGTCAGCAGGACAGGAATATCTCGAGATATTCCTGTCCTGCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026400.4-661s21c1
Sequence:CCGGAGGCTCCTGGCAAACGGAAATCTCGAGATTTCCGTTTGCCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026400.4-1502s21c1
Sequence:CCGGCTCAGCACCTCTGCAACATTTCTCGAGAAATGTTGCAGAGGTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016306
VALIDATED
DNAJB11 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-1373s1c1
Sequence:CCGGGAAATGAATAAGAGGGCTTAACTCGAGTTAAGCCCTCTTATTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-406s1c1
Sequence:CCGGCGGAAACAGTACGATACTTATCTCGAGATAAGTATCGTACTGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-866s1c1
Sequence:CCGGCTGGAGATTTACGGTTCCGAACTCGAGTTCGGAACCGTAAATCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-255s1c1
Sequence:CCGGGCCTCGAAGTGCCTCTATAAACTCGAGTTTATAGAGGCACTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-970s1c1
Sequence:CCGGGTTGGCTTTGAGATGGATATTCTCGAGAATATCCATCTCAAAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-953s21c1
Sequence:CCGGGTTGTCAAGCACCCAATATTTCTCGAGAAATATTGGGTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-278s21c1
Sequence:CCGGGTGATTGCCGGACGAGATTTCCTCGAGGAAATCTCGTCCGGCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1542s21c1
Sequence:CCGGCGCCTGAGTTTCAAGAATTAACTCGAGTTAATTCTTGAAACTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-794s21c1
Sequence:CCGGGTCTGCGACGAATGCCCTAATCTCGAGATTAGGGCATTCGTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-581s21c1
Sequence:CCGGCCTCGTCAGCAAGACAGAAATCTCGAGATTTCTGTCTTGCTGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1392s21c1
Sequence:CCGGATATGCAAGTTAGGCTTAATTCTCGAGAATTAAGCCTAACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-1288s21c1
Sequence:CCGGAGGATATTGAGAGTGAATAAACTCGAGTTTATTCACTCTCAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016306
VALIDATED
DNAJB11 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-1373s1c1
Sequence:CCGGGAAATGAATAAGAGGGCTTAACTCGAGTTAAGCCCTCTTATTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-406s1c1
Sequence:CCGGCGGAAACAGTACGATACTTATCTCGAGATAAGTATCGTACTGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-866s1c1
Sequence:CCGGCTGGAGATTTACGGTTCCGAACTCGAGTTCGGAACCGTAAATCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-255s1c1
Sequence:CCGGGCCTCGAAGTGCCTCTATAAACTCGAGTTTATAGAGGCACTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-970s1c1
Sequence:CCGGGTTGGCTTTGAGATGGATATTCTCGAGAATATCCATCTCAAAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-953s21c1
Sequence:CCGGGTTGTCAAGCACCCAATATTTCTCGAGAAATATTGGGTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-278s21c1
Sequence:CCGGGTGATTGCCGGACGAGATTTCCTCGAGGAAATCTCGTCCGGCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1542s21c1
Sequence:CCGGCGCCTGAGTTTCAAGAATTAACTCGAGTTAATTCTTGAAACTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-794s21c1
Sequence:CCGGGTCTGCGACGAATGCCCTAATCTCGAGATTAGGGCATTCGTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-581s21c1
Sequence:CCGGCCTCGTCAGCAAGACAGAAATCTCGAGATTTCTGTCTTGCTGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1392s21c1
Sequence:CCGGATATGCAAGTTAGGCTTAATTCTCGAGAATTAAGCCTAACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-1288s21c1
Sequence:CCGGAGGATATTGAGAGTGAATAAACTCGAGTTTATTCACTCTCAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016306
VALIDATED
DNAJB11 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-1373s1c1
Sequence:CCGGGAAATGAATAAGAGGGCTTAACTCGAGTTAAGCCCTCTTATTCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-406s1c1
Sequence:CCGGCGGAAACAGTACGATACTTATCTCGAGATAAGTATCGTACTGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-866s1c1
Sequence:CCGGCTGGAGATTTACGGTTCCGAACTCGAGTTCGGAACCGTAAATCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016306.3-255s1c1
Sequence:CCGGGCCTCGAAGTGCCTCTATAAACTCGAGTTTATAGAGGCACTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016306.3-970s1c1
Sequence:CCGGGTTGGCTTTGAGATGGATATTCTCGAGAATATCCATCTCAAAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-953s21c1
Sequence:CCGGGTTGTCAAGCACCCAATATTTCTCGAGAAATATTGGGTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-278s21c1
Sequence:CCGGGTGATTGCCGGACGAGATTTCCTCGAGGAAATCTCGTCCGGCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1542s21c1
Sequence:CCGGCGCCTGAGTTTCAAGAATTAACTCGAGTTAATTCTTGAAACTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-794s21c1
Sequence:CCGGGTCTGCGACGAATGCCCTAATCTCGAGATTAGGGCATTCGTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-581s21c1
Sequence:CCGGCCTCGTCAGCAAGACAGAAATCTCGAGATTTCTGTCTTGCTGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016306.4-1392s21c1
Sequence:CCGGATATGCAAGTTAGGCTTAATTCTCGAGAATTAAGCCTAACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016306.4-1288s21c1
Sequence:CCGGAGGATATTGAGAGTGAATAAACTCGAGTTTATTCACTCTCAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks