EMAIL THIS PAGE TO A FRIEND

DNAJB12

DnaJ (Hsp40) homolog, subfamily B, member 12

114 Gene Product Result for
Synonyms: DJ10
UniProtKB ID: Q9NXW2, B7Z7I3, Q9H6H0
Gene ID:
Human(54788) Summary: DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]
Mouse(56709) DnaJ (Hsp40) homolog, subfamily B, member 12
Rat(294513) DnaJ (Hsp40) homolog, subfamily B, member 12
domestic guinea pig(100714781) DnaJ (Hsp40) homolog, subfamily B, member 12
naked mole-rat(101698082) DnaJ (Hsp40) homolog, subfamily B, member 12
Goat(100861354) DnaJ (Hsp40) homolog, subfamily B, member 12
sheep(101114845) DnaJ (Hsp40) homolog, subfamily B, member 12
chicken(423707) DnaJ (Hsp40) homolog, subfamily B, member 12
cow(533603) DnaJ (Hsp40) homolog, subfamily B, member 12
domestic cat(101082344) DnaJ (Hsp40) homolog, subfamily B, member 12
Horse(100063614) DnaJ (Hsp40) homolog, subfamily B, member 12
dog(489039) DnaJ (Hsp40) homolog, subfamily B, member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002762 Rosetta Predictions human pricing
NM_017626 Rosetta Predictions human pricing
NM_001013907 Rosetta Predictions rat pricing
NM_019965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135845 predicted 220
2 SASI_Hs01_00135846 predicted 341
3 SASI_Hs01_00135847 predicted 232
4 SASI_Hs01_00135848 predicted 1024
5 SASI_Hs01_00135849 predicted 853
6 SASI_Hs01_00135850 predicted 720
7 SASI_Hs01_00135851 predicted 369
8 SASI_Hs01_00135852 predicted 335
9 SASI_Hs01_00135853 predicted 883
10 SASI_Hs02_00304197 predicted 1076
11 SASI_Hs01_00135844 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167019 predicted 221
2 SASI_Hs01_00167020 predicted 345
3 SASI_Hs01_00167021 predicted 225
4 SASI_Hs01_00167022 predicted 1023
5 SASI_Hs01_00167023 predicted 851
6 SASI_Hs01_00167024 predicted 720
7 SASI_Hs01_00167025 predicted 370
8 SASI_Hs01_00167026 predicted 331
9 SASI_Hs01_00167027 predicted 881
10 SASI_Hs02_00350301 predicted 1076
11 SASI_Hs01_00167018 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106981 predicted 1204
2 SASI_Rn01_00106982 predicted 763
3 SASI_Rn01_00106983 predicted 1270
4 SASI_Rn01_00106984 predicted 1059
5 SASI_Rn01_00106985 predicted 509
6 SASI_Rn01_00106986 predicted 628
7 SASI_Rn01_00106987 predicted 780
8 SASI_Rn01_00106988 predicted 440
9 SASI_Rn01_00106989 predicted 1096
10 SASI_Rn02_00201192 predicted 1339
11 SASI_Rn01_00106990 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040051 predicted 1377
2 SASI_Mm01_00040052 predicted 803
3 SASI_Mm01_00040053 predicted 1222
4 SASI_Mm01_00040054 predicted 1118
5 SASI_Mm01_00040055 predicted 1302
6 SASI_Mm01_00040056 predicted 591
7 SASI_Mm01_00040057 predicted 762
8 SASI_Mm01_00040058 predicted 403
9 SASI_Mm01_00040059 predicted 473
10 SASI_Mm01_00040060 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017626
VALIDATED
DNAJB12 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-508s21c1
Sequence:CCGGGCTGGAGGAGAGAGCACCAAACTCGAGTTTGGTGCTCTCTCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017626.4-1451s21c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-1005s21c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-704s21c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-771s1c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-1217s1c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017626.2-692s1c1
Sequence:CCGGTGCGCTATACCTACCAGCAAACTCGAGTTTGCTGGTAGGTATAGCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-470s1c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017626
VALIDATED
DNAJB12 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-508s21c1
Sequence:CCGGGCTGGAGGAGAGAGCACCAAACTCGAGTTTGGTGCTCTCTCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017626.4-1451s21c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-1005s21c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-704s21c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-771s1c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-1217s1c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017626.2-692s1c1
Sequence:CCGGTGCGCTATACCTACCAGCAAACTCGAGTTTGCTGGTAGGTATAGCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-470s1c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017626
VALIDATED
DNAJB12 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-508s21c1
Sequence:CCGGGCTGGAGGAGAGAGCACCAAACTCGAGTTTGGTGCTCTCTCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017626.4-1451s21c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-1005s21c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017626.4-704s21c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-771s1c1
Sequence:CCGGGCCTATCCTCATCCTGATTCTCTCGAGAGAATCAGGATGAGGATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-1217s1c1
Sequence:CCGGGCCAAGGTGATGGACTGTATACTCGAGTATACAGTCCATCACCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017626.2-692s1c1
Sequence:CCGGTGCGCTATACCTACCAGCAAACTCGAGTTTGCTGGTAGGTATAGCGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017626.2-470s1c1
Sequence:CCGGTCAAAGCCATTGGCACAGCATCTCGAGATGCTGTGCCAATGGCTTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019965
VALIDATED
DNAJB12 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-407s21c1
Sequence:CCGGAGCAGTGTAAAGATTACTATGCTCGAGCATAGTAATCTTTACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1027s21c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1143s21c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-495s21c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019965.2-1293s21c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1293s1c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-495s1c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1143s1c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1027s1c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-600s1c1
Sequence:CCGGCGACCAGTTTGGTGATGACAACTCGAGTTGTCATCACCAAACTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019965
VALIDATED
DNAJB12 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-407s21c1
Sequence:CCGGAGCAGTGTAAAGATTACTATGCTCGAGCATAGTAATCTTTACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1027s21c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1143s21c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-495s21c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019965.2-1293s21c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1293s1c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-495s1c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1143s1c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1027s1c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-600s1c1
Sequence:CCGGCGACCAGTTTGGTGATGACAACTCGAGTTGTCATCACCAAACTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019965
VALIDATED
DNAJB12 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-407s21c1
Sequence:CCGGAGCAGTGTAAAGATTACTATGCTCGAGCATAGTAATCTTTACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1027s21c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-1143s21c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019965.2-495s21c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019965.2-1293s21c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1293s1c1
Sequence:CCGGGCCACAGTGATGGACTGTATACTCGAGTATACAGTCCATCACTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-495s1c1
Sequence:CCGGCAAGTTCCATCCAGACAAGAACTCGAGTTCTTGTCTGGATGGAACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1143s1c1
Sequence:CCGGGTACCACAGAGCACAGAAGATCTCGAGATCTTCTGTGCTCTGTGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-1027s1c1
Sequence:CCGGGTGGAACGGAATGTAGAGGATCTCGAGATCCTCTACATTCCGTTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019965.2-600s1c1
Sequence:CCGGCGACCAGTTTGGTGATGACAACTCGAGTTGTCATCACCAAACTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)