EMAIL THIS PAGE TO A FRIEND

DNAJB13

DnaJ (Hsp40) homolog, subfamily B, member 13

45 Gene Product Result for
Synonyms: RSPH16A TSARG5 TSARG6
UniProtKB ID: P59910, B3LEP4, Q8IZW5
Gene ID:
Human(374407) Summary: DNAJA13 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins. For background information on the DNAJ family, see 608375.[supplied by OMIM, Mar 2008]
Mouse(69387) DnaJ (Hsp40) related, subfamily B, member 13
Rat(308857) DnaJ (Hsp40) homolog, subfamily B, member 13
Zebrafish(572669) DnaJ (Hsp40) related, subfamily B, member 13
domestic cat(101096099) DnaJ (Hsp40) homolog, subfamily B, member 13
cow(520270) DnaJ (Hsp40) homolog, subfamily B, member 13
dog(476809) DnaJ (Hsp40) homolog, subfamily B, member 13
chicken(419060) DnaJ (Hsp40) homolog, subfamily B, member 13
sheep(101104684) DnaJ (Hsp40) homolog, subfamily B, member 13
naked mole-rat(101714254) DnaJ (Hsp40) homolog, subfamily B, member 13
domestic guinea pig(100727552) DnaJ (Hsp40) homolog, subfamily B, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153614 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099441 MISSION® esiRNA esiRNA human DNAJB13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153614 Rosetta Predictions human pricing
NM_001005885 Rosetta Predictions rat pricing
NM_153527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114496 predicted 1098
2 SASI_Hs01_00114498 predicted 1274
3 SASI_Hs01_00114499 predicted 1192
4 SASI_Hs01_00114500 predicted 894
5 SASI_Hs01_00114501 predicted 1428
6 SASI_Hs01_00114502 predicted 829
7 SASI_Hs02_00367356 predicted 859
8 SASI_Hs01_00114503 predicted 936
9 SASI_Hs01_00114504 predicted 796
10 SASI_Hs01_00114505 predicted 1325
11 SASI_Hs01_00114497 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198461 predicted 628
2 SASI_Rn02_00198462 predicted 513
3 SASI_Rn02_00198463 predicted 1261
4 SASI_Rn02_00198464 predicted 1413
5 SASI_Rn02_00198465 predicted 405
6 SASI_Rn02_00198466 predicted 453
7 SASI_Rn02_00198467 predicted 618
8 SASI_Rn02_00198468 predicted 415
9 SASI_Rn02_00198469 predicted 349
10 SASI_Rn02_00198470 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122082 predicted 850
2 SASI_Mm02_00343292 predicted 569
3 SASI_Mm01_00122083 predicted 781
4 SASI_Mm01_00122084 predicted 494
5 SASI_Mm01_00122085 predicted 338
6 SASI_Mm01_00122086 predicted 403
7 SASI_Mm01_00122087 predicted 224
8 SASI_Mm01_00122088 predicted 669
9 SASI_Mm01_00122089 predicted 467
10 SASI_Mm01_00122090 predicted 221
11 SASI_Mm01_00122091 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153527
DNAJB13 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-820s1c1
Sequence:CCGGGCTGCTCAACATCCCTATCAACTCGAGTTGATAGGGATGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153527.2-1020s1c1
Sequence:CCGGGAGCAGGAACAGGGATGGAGACTCGAGTCTCCATCCCTGTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-235s1c1
Sequence:CCGGGCGAGGCATCTATGACAAGTTCTCGAGAACTTGTCATAGATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-850s1c1
Sequence:CCGGCCACCCTAAGTACTTCAAGATCTCGAGATCTTGAAGTACTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-176s1c1
Sequence:CCGGGCACCAGAGATATTCAAGCAACTCGAGTTGCTTGAATATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-535s21c1
Sequence:CCGGGATCTCCCGAAGGGTACTAAACTCGAGTTTAGTACCCTTCGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-473s21c1
Sequence:CCGGATTGAACGAGACCTCTATCTGCTCGAGCAGATAGAGGTCTCGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153527
DNAJB13 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-820s1c1
Sequence:CCGGGCTGCTCAACATCCCTATCAACTCGAGTTGATAGGGATGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153527.2-1020s1c1
Sequence:CCGGGAGCAGGAACAGGGATGGAGACTCGAGTCTCCATCCCTGTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-235s1c1
Sequence:CCGGGCGAGGCATCTATGACAAGTTCTCGAGAACTTGTCATAGATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-850s1c1
Sequence:CCGGCCACCCTAAGTACTTCAAGATCTCGAGATCTTGAAGTACTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-176s1c1
Sequence:CCGGGCACCAGAGATATTCAAGCAACTCGAGTTGCTTGAATATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-535s21c1
Sequence:CCGGGATCTCCCGAAGGGTACTAAACTCGAGTTTAGTACCCTTCGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-473s21c1
Sequence:CCGGATTGAACGAGACCTCTATCTGCTCGAGCAGATAGAGGTCTCGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153527
DNAJB13 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-820s1c1
Sequence:CCGGGCTGCTCAACATCCCTATCAACTCGAGTTGATAGGGATGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153527.2-1020s1c1
Sequence:CCGGGAGCAGGAACAGGGATGGAGACTCGAGTCTCCATCCCTGTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-235s1c1
Sequence:CCGGGCGAGGCATCTATGACAAGTTCTCGAGAACTTGTCATAGATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-850s1c1
Sequence:CCGGCCACCCTAAGTACTTCAAGATCTCGAGATCTTGAAGTACTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153527.2-176s1c1
Sequence:CCGGGCACCAGAGATATTCAAGCAACTCGAGTTGCTTGAATATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-535s21c1
Sequence:CCGGGATCTCCCGAAGGGTACTAAACTCGAGTTTAGTACCCTTCGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153527.2-473s21c1
Sequence:CCGGATTGAACGAGACCTCTATCTGCTCGAGCAGATAGAGGTCTCGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153614
DNAJB13 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 13
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1423s1c1
Sequence:CCGGCAGGGAGAATGACAACCTCTTCTCGAGAAGAGGTTGTCATTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1324s1c1
Sequence:CCGGCACACGCATCACCTTTGAGAACTCGAGTTCTCAAAGGTGATGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-940s1c1
Sequence:CCGGCTACGACAAGTTTGGAGAAGACTCGAGTCTTCTCCAAACTTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1280s1c1
Sequence:CCGGGACAAGATCCTGACCATTGATCTCGAGATCAATGGTCAGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153614
DNAJB13 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 13
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1423s1c1
Sequence:CCGGCAGGGAGAATGACAACCTCTTCTCGAGAAGAGGTTGTCATTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1324s1c1
Sequence:CCGGCACACGCATCACCTTTGAGAACTCGAGTTCTCAAAGGTGATGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-940s1c1
Sequence:CCGGCTACGACAAGTTTGGAGAAGACTCGAGTCTTCTCCAAACTTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1280s1c1
Sequence:CCGGGACAAGATCCTGACCATTGATCTCGAGATCAATGGTCAGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153614
DNAJB13 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 13
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1423s1c1
Sequence:CCGGCAGGGAGAATGACAACCTCTTCTCGAGAAGAGGTTGTCATTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1324s1c1
Sequence:CCGGCACACGCATCACCTTTGAGAACTCGAGTTCTCAAAGGTGATGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-940s1c1
Sequence:CCGGCTACGACAAGTTTGGAGAAGACTCGAGTCTTCTCCAAACTTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153614.2-1280s1c1
Sequence:CCGGGACAAGATCCTGACCATTGATCTCGAGATCAATGGTCAGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks