EMAIL THIS PAGE TO A FRIEND

DNAJB14

DnaJ (Hsp40) homolog, subfamily B, member 14

160 Gene Product Result for
Synonyms: EGNR9427 PRO34683
UniProtKB ID: Q8TBM8, Q6UXN1, Q7Z3P0, Q86TA7, Q86TM0, Q9GZU9
Gene ID:
Mouse(70604) DnaJ (Hsp40) homolog, subfamily B, member 14
Rat(499716) DnaJ (Hsp40) homolog, subfamily B, member 14
domestic guinea pig(100735363) DnaJ (Hsp40) homolog, subfamily B, member 14
naked mole-rat(101701611) DnaJ (Hsp40) homolog, subfamily B, member 14
sheep(101109970) DnaJ (Hsp40) homolog, subfamily B, member 14
chicken(426362) DnaJ (Hsp40) homolog, subfamily B, member 14
cow(538849) DnaJ (Hsp40) homolog, subfamily B, member 14
Horse(100066821) DnaJ (Hsp40) homolog, subfamily B, member 14
domestic cat(101099122) DnaJ (Hsp40) homolog, subfamily B, member 14
dog(487875) DnaJ (Hsp40) homolog, subfamily B, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031723 Rosetta Predictions human pricing
NM_024920 Rosetta Predictions human pricing
XM_001473173 Rosetta Predictions mouse pricing
XM_131212 Rosetta Predictions mouse pricing
XM_924518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175086 predicted 614
2 SASI_Hs01_00175090 predicted 572
3 SASI_Hs02_00307764 predicted 603
4 SASI_Hs02_00307765 predicted 605
5 SASI_Hs02_00307766 predicted 415
6 SASI_Hs02_00307767 predicted 260
7 SASI_Hs02_00307768 predicted 472
8 SASI_Hs02_00307769 predicted 239
9 SASI_Hs02_00307770 predicted 422
10 SASI_Hs02_00307771 predicted 148
11 SASI_Hs01_00175087 predicted 905
12 SASI_Hs01_00175088 predicted 829
13 SASI_Hs01_00175089 predicted 846
14 SASI_Hs01_00175091 predicted 1043
15 SASI_Hs01_00175092 predicted 771
16 SASI_Hs01_00175093 predicted 832
17 SASI_Hs01_00175094 predicted 1001
18 SASI_Hs01_00175095 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070923 predicted 2621
2 SASI_Hs01_00070927 predicted 2578
3 SASI_Hs02_00357536 predicted 2606
4 SASI_Hs02_00357537 predicted 2607
5 SASI_Hs02_00357538 predicted 2421
6 SASI_Hs02_00357539 predicted 2479
7 SASI_Hs02_00357540 predicted 2420
8 SASI_Hs02_00357541 predicted 2352
9 SASI_Hs02_00357542 predicted 2471
10 SASI_Hs02_00357543 predicted 2525
11 SASI_Hs01_00070924 predicted 2909
12 SASI_Hs01_00070925 predicted 2830
13 SASI_Hs01_00070926 predicted 2851
14 SASI_Hs01_00070928 predicted 3053
15 SASI_Hs01_00070929 predicted 2767
16 SASI_Hs01_00070930 predicted 2834
17 SASI_Hs01_00070931 predicted 2995
18 SASI_Hs01_00070932 predicted 2708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366476 predicted 1095
2 SASI_Mm02_00366477 predicted 1057
3 SASI_Mm02_00366478 predicted 1103
4 SASI_Mm02_00366479 predicted 1096
5 SASI_Mm02_00366480 predicted 1156
6 SASI_Mm02_00366481 predicted 1103
7 SASI_Mm02_00366482 predicted 1165
8 SASI_Mm02_00366483 predicted 1105
9 SASI_Mm02_00366484 predicted 1092
10 SASI_Mm02_00366485 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236828 predicted 1100
2 SASI_Mm01_00236829 predicted 1050
3 SASI_Mm01_00236830 predicted 673
4 SASI_Mm01_00236831 predicted 1151
5 SASI_Mm01_00236832 predicted 1105
6 SASI_Mm01_00236833 predicted 509
7 SASI_Mm01_00236834 predicted 1355
8 SASI_Mm01_00236835 predicted 1344
9 SASI_Mm01_00236836 predicted 645
10 SASI_Mm01_00236837 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444179 predicted 938
2 SASI_Mm02_00444180 predicted 889
3 SASI_Mm02_00444181 predicted 994
4 SASI_Mm02_00444182 predicted 939
5 SASI_Mm02_00444183 predicted 1200
6 SASI_Mm02_00444184 predicted 1178
7 SASI_Mm02_00444185 predicted 490
8 SASI_Mm02_00444186 predicted 648
9 SASI_Mm02_00444187 predicted 497
10 SASI_Mm02_00444188 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033155
VALIDATED
DNAJB14 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-576s21c1
Sequence:CCGGCTACGAAGTCCTCGGAGTTACCTCGAGGTAACTCCGAGGACTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1614s21c1
Sequence:CCGGCAAAGTCTGGAGAGGATTATCCTCGAGGATAATCCTCTCCAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1144s21c1
Sequence:CCGGTACGTCAGTAAGGACTTTAAACTCGAGTTTAAAGTCCTTACTGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-840s21c1
Sequence:CCGGTCCCGAAGACCTGTTCAATATCTCGAGATATTGAACAGGTCTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1221s21c1
Sequence:CCGGCGTGACTAATATTCGAAATAACTCGAGTTATTTCGAATATTAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033155
VALIDATED
DNAJB14 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-576s21c1
Sequence:CCGGCTACGAAGTCCTCGGAGTTACCTCGAGGTAACTCCGAGGACTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1614s21c1
Sequence:CCGGCAAAGTCTGGAGAGGATTATCCTCGAGGATAATCCTCTCCAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1144s21c1
Sequence:CCGGTACGTCAGTAAGGACTTTAAACTCGAGTTTAAAGTCCTTACTGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-840s21c1
Sequence:CCGGTCCCGAAGACCTGTTCAATATCTCGAGATATTGAACAGGTCTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1221s21c1
Sequence:CCGGCGTGACTAATATTCGAAATAACTCGAGTTATTTCGAATATTAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033155
VALIDATED
DNAJB14 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-576s21c1
Sequence:CCGGCTACGAAGTCCTCGGAGTTACCTCGAGGTAACTCCGAGGACTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1614s21c1
Sequence:CCGGCAAAGTCTGGAGAGGATTATCCTCGAGGATAATCCTCTCCAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1144s21c1
Sequence:CCGGTACGTCAGTAAGGACTTTAAACTCGAGTTTAAAGTCCTTACTGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-840s21c1
Sequence:CCGGTCCCGAAGACCTGTTCAATATCTCGAGATATTGAACAGGTCTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033155.1-1221s21c1
Sequence:CCGGCGTGACTAATATTCGAAATAACTCGAGTTATTTCGAATATTAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031723
VALIDATED
DNAJB14 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-902s21c1
Sequence:CCGGATCCAGCTGATGCCCATAATTCTCGAGAATTATGGGCATCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-1124s21c1
Sequence:CCGGGTGACTAATATTCGAAATAACCTCGAGGTTATTTCGAATATTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-360s21c1
Sequence:CCGGGCGATCAAAGCAAGCCTAATTCTCGAGAATTAGGCTTGCTTTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031723.2-1260s21c1
Sequence:CCGGAGCGGCTTACCAGTCTTTATACTCGAGTATAAAGACTGGTAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031723.2-1412s21c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031723
VALIDATED
DNAJB14 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-902s21c1
Sequence:CCGGATCCAGCTGATGCCCATAATTCTCGAGAATTATGGGCATCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-1124s21c1
Sequence:CCGGGTGACTAATATTCGAAATAACCTCGAGGTTATTTCGAATATTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-360s21c1
Sequence:CCGGGCGATCAAAGCAAGCCTAATTCTCGAGAATTAGGCTTGCTTTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031723.2-1260s21c1
Sequence:CCGGAGCGGCTTACCAGTCTTTATACTCGAGTATAAAGACTGGTAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031723.2-1412s21c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031723
VALIDATED
DNAJB14 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-902s21c1
Sequence:CCGGATCCAGCTGATGCCCATAATTCTCGAGAATTATGGGCATCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-1124s21c1
Sequence:CCGGGTGACTAATATTCGAAATAACCTCGAGGTTATTTCGAATATTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031723.2-360s21c1
Sequence:CCGGGCGATCAAAGCAAGCCTAATTCTCGAGAATTAGGCTTGCTTTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031723.2-1260s21c1
Sequence:CCGGAGCGGCTTACCAGTCTTTATACTCGAGTATAAAGACTGGTAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031723.2-1412s21c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024920
VALIDATED
DNAJB14 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-2539s1c1
Sequence:CCGGCGGGCAATGAAGAACAAGCATCTCGAGATGCTTGTTCTTCATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-3012s1c1
Sequence:CCGGCGAAATAACTGCTGGAAAGAACTCGAGTTCTTTCCAGCAGTTATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3288s1c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-4350s1c1
Sequence:CCGGGCTCCTTGTAAGTAAATCCATCTCGAGATGGATTTACTTACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-2596s1c1
Sequence:CCGGGAGGTTGTGAAGCTGATATAACTCGAGTTATATCAGCTTCACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024920.3-3124s1c1
Sequence:CCGGGTAAAGAATTAGAGCGGCTTACTCGAGTAAGCCGCTCTAATTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3425s1c1
Sequence:CCGGGAAAGGATTATCACACCTGTACTCGAGTACAGGTGTGATAATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024920
VALIDATED
DNAJB14 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-2539s1c1
Sequence:CCGGCGGGCAATGAAGAACAAGCATCTCGAGATGCTTGTTCTTCATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-3012s1c1
Sequence:CCGGCGAAATAACTGCTGGAAAGAACTCGAGTTCTTTCCAGCAGTTATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3288s1c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-4350s1c1
Sequence:CCGGGCTCCTTGTAAGTAAATCCATCTCGAGATGGATTTACTTACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-2596s1c1
Sequence:CCGGGAGGTTGTGAAGCTGATATAACTCGAGTTATATCAGCTTCACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024920.3-3124s1c1
Sequence:CCGGGTAAAGAATTAGAGCGGCTTACTCGAGTAAGCCGCTCTAATTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3425s1c1
Sequence:CCGGGAAAGGATTATCACACCTGTACTCGAGTACAGGTGTGATAATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024920
VALIDATED
DNAJB14 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-2539s1c1
Sequence:CCGGCGGGCAATGAAGAACAAGCATCTCGAGATGCTTGTTCTTCATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-3012s1c1
Sequence:CCGGCGAAATAACTGCTGGAAAGAACTCGAGTTCTTTCCAGCAGTTATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3288s1c1
Sequence:CCGGCCTGAAATCTTGGACTGTTTACTCGAGTAAACAGTCCAAGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-4350s1c1
Sequence:CCGGGCTCCTTGTAAGTAAATCCATCTCGAGATGGATTTACTTACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024920.3-2596s1c1
Sequence:CCGGGAGGTTGTGAAGCTGATATAACTCGAGTTATATCAGCTTCACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024920.3-3124s1c1
Sequence:CCGGGTAAAGAATTAGAGCGGCTTACTCGAGTAAGCCGCTCTAATTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024920.3-3425s1c1
Sequence:CCGGGAAAGGATTATCACACCTGTACTCGAGTACAGGTGTGATAATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks