EMAIL THIS PAGE TO A FRIEND

DNAJB1

DnaJ (Hsp40) homolog, subfamily B, member 1

104 Gene Product Result for
Synonyms: HSPF1 Hdj1 Hsp40 RSPH16B Sis1
UniProtKB ID: P25685
Gene ID:
Mouse(81489) DnaJ (Hsp40) homolog, subfamily B, member 1
Rat(361384) DnaJ (Hsp40) homolog, subfamily B, member 1
domestic guinea pig(100713788) DnaJ (Hsp40) homolog, subfamily B, member 1
naked mole-rat(101715469) DnaJ (Hsp40) homolog, subfamily B, member 1
sheep(101122104) DnaJ (Hsp40) homolog, subfamily B, member 1
cow(538426) DnaJ (Hsp40) homolog, subfamily B, member 1
domestic cat(101092586) DnaJ (Hsp40) homolog, subfamily B, member 1
dog(476688) DnaJ (Hsp40) homolog, subfamily B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006145 Rosetta Predictions human pricing
NM_001108441 Rosetta Predictions rat pricing
NM_018808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079669 predicted 1219
2 SASI_Hs01_00079670 predicted 1166
3 SASI_Hs01_00079671 predicted 361
4 SASI_Hs01_00079672 predicted 877
5 SASI_Hs01_00079673 predicted 736
6 SASI_Hs01_00079674 predicted 306
7 SASI_Hs01_00079676 predicted 975
8 SASI_Hs01_00079677 predicted 1193
9 SASI_Hs01_00079678 predicted 1033
10 SASI_Hs02_00340985 predicted 295
11 SASI_Hs01_00079675 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238669 predicted 1217
2 SASI_Rn02_00238670 predicted 1242
3 SASI_Rn02_00238671 predicted 946
4 SASI_Rn02_00238672 predicted 388
5 SASI_Rn02_00238673 predicted 1025
6 SASI_Rn02_00238674 predicted 589
7 SASI_Rn02_00238675 predicted 817
8 SASI_Rn02_00238676 predicted 870
9 SASI_Rn02_00238677 predicted 570
10 SASI_Rn02_00238678 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053990 predicted 943
2 SASI_Mm01_00053991 predicted 1087
3 SASI_Mm01_00053992 predicted 384
4 SASI_Mm01_00053993 predicted 1092
5 SASI_Mm01_00053994 predicted 510
6 SASI_Mm01_00053995 predicted 817
7 SASI_Mm01_00053997 predicted 874
8 SASI_Mm01_00053998 predicted 711
9 SASI_Mm01_00053999 predicted 570
10 SASI_Mm02_00324147 predicted 710
11 SASI_Mm01_00053996 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006145
VALIDATED
DNAJB1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-788s21c1
Sequence:CCGGGATGGCTCTGATGTCATTTATCTCGAGATAAATGACATCAGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-302s21c1
Sequence:CCGGACCTCTTTCAGCTACACATTCCTCGAGGAATGTGTAGCTGAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006145.1-1429s21c1
Sequence:CCGGGTCAACCTGCAGTCTTGATTCCTCGAGGAATCAAGACTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-327s21c1
Sequence:CCGGGAGACCCTCATGCCATGTTTGCTCGAGCAAACATGGCATGAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-616s1c1
Sequence:CCGGCGACGGAAAGAGCATTCGAAACTCGAGTTTCGAATGCTCTTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-723s1c1
Sequence:CCGGCCAACAACATTCCAGCTGATACTCGAGTATCAGCTGGAATGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-886s1c1
Sequence:CCGGCGTCGTATTCAAAGATGTTATCTCGAGATAACATCTTTGAATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-2036s1c1
Sequence:CCGGGCTCTCTGTATAGGGCCATAACTCGAGTTATGGCCCTATACAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-571s1c1
Sequence:CCGGCGGCTGTACCAAGAAGATGAACTCGAGTTCATCTTCTTGGTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006145
VALIDATED
DNAJB1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-788s21c1
Sequence:CCGGGATGGCTCTGATGTCATTTATCTCGAGATAAATGACATCAGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-302s21c1
Sequence:CCGGACCTCTTTCAGCTACACATTCCTCGAGGAATGTGTAGCTGAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006145.1-1429s21c1
Sequence:CCGGGTCAACCTGCAGTCTTGATTCCTCGAGGAATCAAGACTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-327s21c1
Sequence:CCGGGAGACCCTCATGCCATGTTTGCTCGAGCAAACATGGCATGAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-616s1c1
Sequence:CCGGCGACGGAAAGAGCATTCGAAACTCGAGTTTCGAATGCTCTTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-723s1c1
Sequence:CCGGCCAACAACATTCCAGCTGATACTCGAGTATCAGCTGGAATGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-886s1c1
Sequence:CCGGCGTCGTATTCAAAGATGTTATCTCGAGATAACATCTTTGAATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-2036s1c1
Sequence:CCGGGCTCTCTGTATAGGGCCATAACTCGAGTTATGGCCCTATACAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-571s1c1
Sequence:CCGGCGGCTGTACCAAGAAGATGAACTCGAGTTCATCTTCTTGGTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006145
VALIDATED
DNAJB1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-788s21c1
Sequence:CCGGGATGGCTCTGATGTCATTTATCTCGAGATAAATGACATCAGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-302s21c1
Sequence:CCGGACCTCTTTCAGCTACACATTCCTCGAGGAATGTGTAGCTGAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006145.1-1429s21c1
Sequence:CCGGGTCAACCTGCAGTCTTGATTCCTCGAGGAATCAAGACTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006145.1-327s21c1
Sequence:CCGGGAGACCCTCATGCCATGTTTGCTCGAGCAAACATGGCATGAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-616s1c1
Sequence:CCGGCGACGGAAAGAGCATTCGAAACTCGAGTTTCGAATGCTCTTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-723s1c1
Sequence:CCGGCCAACAACATTCCAGCTGATACTCGAGTATCAGCTGGAATGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-886s1c1
Sequence:CCGGCGTCGTATTCAAAGATGTTATCTCGAGATAACATCTTTGAATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-2036s1c1
Sequence:CCGGGCTCTCTGTATAGGGCCATAACTCGAGTTATGGCCCTATACAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006145.1-571s1c1
Sequence:CCGGCGGCTGTACCAAGAAGATGAACTCGAGTTCATCTTCTTGGTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018808
VALIDATED
DNAJB1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-717s21c1
Sequence:CCGGATGGAAAGAGCATTCGAAATGCTCGAGCATTTCGAATGCTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018808.1-510s21c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1218s21c1
Sequence:CCGGACCGTTCCACTGGTTGCATATCTCGAGATATGCAACCAGTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-831s21c1
Sequence:CCGGTTCCAGCAGACATCGTCTTTGCTCGAGCAAAGACGATGTCTGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1076s21c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-2118s1c1
Sequence:CCGGGCGTGAAAGTATCTGTTCTTTCTCGAGAAAGAACAGATACTTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-869s1c1
Sequence:CCGGCACAATATCTTCAAGAGAGATCTCGAGATCTCTCTTGAAGATATTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-1076s1c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018808.1-564s1c1
Sequence:CCGGCCAACATGAACTTTGGACGTTCTCGAGAACGTCCAAAGTTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-510s1c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018808
VALIDATED
DNAJB1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-717s21c1
Sequence:CCGGATGGAAAGAGCATTCGAAATGCTCGAGCATTTCGAATGCTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018808.1-510s21c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1218s21c1
Sequence:CCGGACCGTTCCACTGGTTGCATATCTCGAGATATGCAACCAGTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-831s21c1
Sequence:CCGGTTCCAGCAGACATCGTCTTTGCTCGAGCAAAGACGATGTCTGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1076s21c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-2118s1c1
Sequence:CCGGGCGTGAAAGTATCTGTTCTTTCTCGAGAAAGAACAGATACTTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-869s1c1
Sequence:CCGGCACAATATCTTCAAGAGAGATCTCGAGATCTCTCTTGAAGATATTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-1076s1c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018808.1-564s1c1
Sequence:CCGGCCAACATGAACTTTGGACGTTCTCGAGAACGTCCAAAGTTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-510s1c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018808
VALIDATED
DNAJB1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-717s21c1
Sequence:CCGGATGGAAAGAGCATTCGAAATGCTCGAGCATTTCGAATGCTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018808.1-510s21c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1218s21c1
Sequence:CCGGACCGTTCCACTGGTTGCATATCTCGAGATATGCAACCAGTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-831s21c1
Sequence:CCGGTTCCAGCAGACATCGTCTTTGCTCGAGCAAAGACGATGTCTGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018808.1-1076s21c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-2118s1c1
Sequence:CCGGGCGTGAAAGTATCTGTTCTTTCTCGAGAAAGAACAGATACTTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-869s1c1
Sequence:CCGGCACAATATCTTCAAGAGAGATCTCGAGATCTCTCTTGAAGATATTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-1076s1c1
Sequence:CCGGGACCTTGTTATCGAGTTTGAACTCGAGTTCAAACTCGATAACAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018808.1-564s1c1
Sequence:CCGGCCAACATGAACTTTGGACGTTCTCGAGAACGTCCAAAGTTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018808.1-510s1c1
Sequence:CCGGGCATGGACATTGATGACACATCTCGAGATGTGTCATCAATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks