EMAIL THIS PAGE TO A FRIEND

DNAJB2

DnaJ (Hsp40) homolog, subfamily B, member 2

186 Gene Product Result for
Synonyms: DSMA5 HSJ-1 HSJ1 HSPF3
UniProtKB ID: P25686, A8K9P6, Q8IUK1, Q8IUK2, Q96F52
Gene ID:
Human(3300) Summary: This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Mouse(56812) DnaJ (Hsp40) homolog, subfamily B, member 2
Rat(689593) DnaJ (Hsp40) homolog, subfamily B, member 2
Zebrafish(561686) DnaJ (Hsp40) homolog, subfamily B, member 2
cow(533668) DnaJ (Hsp40) homolog, subfamily B, member 2
domestic cat(101096504) DnaJ (Hsp40) homolog, subfamily B, member 2
dog(100683427) DnaJ (Hsp40) homolog, subfamily B, member 2
chicken(427022) DnaJ (Hsp40) homolog, subfamily B, member 2
Goat(100861159) DnaJ (Hsp40) homolog, subfamily B, member 2
sheep(101116542) DnaJ (Hsp40) homolog, subfamily B, member 2
naked mole-rat(101717959) DnaJ (Hsp40) homolog, subfamily B, member 2
domestic guinea pig(100734218) DnaJ (Hsp40) homolog, subfamily B, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039550 Rosetta Predictions human pricing
NM_006736 Rosetta Predictions human pricing
NM_001109541 Rosetta Predictions rat pricing
NM_020266 Rosetta Predictions mouse pricing
NM_178055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163716 predicted 1353
2 SASI_Hs01_00163718 predicted 827
3 SASI_Hs01_00163719 predicted 405
4 SASI_Hs01_00163720 predicted 530
5 SASI_Hs01_00163721 predicted 409
6 SASI_Hs01_00163722 predicted 1391
7 SASI_Hs01_00163723 predicted 421
8 SASI_Hs01_00163724 predicted 390
9 SASI_Hs01_00163725 predicted 552
10 SASI_Hs02_00308561 predicted 767
11 SASI_Hs01_00163717 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167364 predicted 826
2 SASI_Hs01_00167365 predicted 400
3 SASI_Hs01_00167366 predicted 538
4 SASI_Hs01_00167367 predicted 403
5 SASI_Hs01_00167368 predicted 414
6 SASI_Hs01_00167369 predicted 397
7 SASI_Hs01_00167370 predicted 554
8 SASI_Hs01_00167371 predicted 761
9 SASI_Hs01_00167363 predicted 541
10 SASI_Hs01_00167372 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249419 predicted 365
2 SASI_Rn02_00249420 predicted 1257
3 SASI_Rn02_00249421 predicted 574
4 SASI_Rn02_00249422 predicted 975
5 SASI_Rn02_00249423 predicted 746
6 SASI_Rn02_00249424 predicted 755
7 SASI_Rn02_00249425 predicted 650
8 SASI_Rn02_00249426 predicted 1071
9 SASI_Rn02_00249427 predicted 639
10 SASI_Rn02_00249428 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074820 predicted 493
2 SASI_Mm01_00074821 predicted 926
3 SASI_Mm01_00074822 predicted 398
4 SASI_Mm01_00074823 predicted 972
5 SASI_Mm01_00074824 predicted 895
6 SASI_Mm01_00074825 predicted 1003
7 SASI_Mm01_00074826 predicted 917
8 SASI_Mm02_00325453 predicted 741
9 SASI_Mm01_00074827 predicted 498
10 SASI_Mm02_00325454 predicted 635
11 SASI_Mm01_00074819 predicted 1077
12 SASI_Mm01_00074828 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348513 predicted 1398
2 SASI_Mm01_00034895 predicted 1053
3 SASI_Mm01_00034896 predicted 955
4 SASI_Mm01_00034897 predicted 1100
5 SASI_Mm01_00034898 predicted 1024
6 SASI_Mm01_00034899 predicted 1125
7 SASI_Mm01_00034900 predicted 1035
8 SASI_Mm01_00034902 predicted 1127
9 SASI_Mm01_00034903 predicted 1050
10 SASI_Mm02_00348514 predicted 1104
11 SASI_Mm01_00034894 predicted 1208
12 SASI_Mm01_00034901 predicted 1119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020266
VALIDATED
DNAJB2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-456s1c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020266.1-933s1c1
Sequence:CCGGCCCTCATTTATGCTGAGTGTACTCGAGTACACTCAGCATAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-214s1c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020266.1-160s1c1
Sequence:CCGGCCAGACAAGAACCCGGATAATCTCGAGATTATCCGGGTTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-748s1c1
Sequence:CCGGGACCATGATCTTTCTGAGGATCTCGAGATCCTCAGAAAGATCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-123s21c1
Sequence:CCGGCAAGAAGGCGTACCGAAAGAACTCGAGTTCTTTCGGTACGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020266.1-456s21c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-214s21c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-246s21c1
Sequence:CCGGTGGTCCTTCTCGATCGGAAACCTCGAGGTTTCCGATCGAGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-983s21c1
Sequence:CCGGCTGAGTGGGAAGCACCTATAGCTCGAGCTATAGGTGCTTCCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020266
VALIDATED
DNAJB2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-456s1c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020266.1-933s1c1
Sequence:CCGGCCCTCATTTATGCTGAGTGTACTCGAGTACACTCAGCATAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-214s1c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020266.1-160s1c1
Sequence:CCGGCCAGACAAGAACCCGGATAATCTCGAGATTATCCGGGTTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-748s1c1
Sequence:CCGGGACCATGATCTTTCTGAGGATCTCGAGATCCTCAGAAAGATCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-123s21c1
Sequence:CCGGCAAGAAGGCGTACCGAAAGAACTCGAGTTCTTTCGGTACGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020266.1-456s21c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-214s21c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-246s21c1
Sequence:CCGGTGGTCCTTCTCGATCGGAAACCTCGAGGTTTCCGATCGAGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-983s21c1
Sequence:CCGGCTGAGTGGGAAGCACCTATAGCTCGAGCTATAGGTGCTTCCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020266
VALIDATED
DNAJB2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-456s1c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020266.1-933s1c1
Sequence:CCGGCCCTCATTTATGCTGAGTGTACTCGAGTACACTCAGCATAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-214s1c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020266.1-160s1c1
Sequence:CCGGCCAGACAAGAACCCGGATAATCTCGAGATTATCCGGGTTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020266.1-748s1c1
Sequence:CCGGGACCATGATCTTTCTGAGGATCTCGAGATCCTCAGAAAGATCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-123s21c1
Sequence:CCGGCAAGAAGGCGTACCGAAAGAACTCGAGTTCTTTCGGTACGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020266.1-456s21c1
Sequence:CCGGCGATTTCTCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-214s21c1
Sequence:CCGGGCAGAGGCCTATGAAGTACTACTCGAGTAGTACTTCATAGGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-246s21c1
Sequence:CCGGTGGTCCTTCTCGATCGGAAACCTCGAGGTTTCCGATCGAGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020266.1-983s21c1
Sequence:CCGGCTGAGTGGGAAGCACCTATAGCTCGAGCTATAGGTGCTTCCCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006736
VALIDATED
DNAJB2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-2398s1c1
Sequence:CCGGCCGGCCTCATTTCTGATAGATCTCGAGATCTATCAGAAATGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006736.4-228s1c1
Sequence:CCGGGATGACATCAAGAAGGCGTATCTCGAGATACGCCTTCTTGATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-773s1c1
Sequence:CCGGGCAGCTGAAGTCAGTCACAATCTCGAGATTGTGACTGACTTCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-363s1c1
Sequence:CCGGCGGGAGATTTACGACCGCTATCTCGAGATAGCGGTCGTAAATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-1155s21c1
Sequence:CCGGAGCAACCAAACGCAGTCCATCCTCGAGGATGGACTGCGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-728s21c1
Sequence:CCGGTTCGCTCTGTTTCTACATCTACTCGAGTAGATGTAGAAACAGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-682s21c1
Sequence:CCGGGATTTCTCCTCCTCATCTTTCCTCGAGGAAAGATGAGGAGGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-1033s21c1
Sequence:CCGGATGGAGGCAGCTGGGAAGAAACTCGAGTTTCTTCCCAGCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006736.5-2079s21c1
Sequence:CCGGTACTGCTTCCCTACCACAAATCTCGAGATTTGTGGTAGGGAAGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006736
VALIDATED
DNAJB2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-2398s1c1
Sequence:CCGGCCGGCCTCATTTCTGATAGATCTCGAGATCTATCAGAAATGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006736.4-228s1c1
Sequence:CCGGGATGACATCAAGAAGGCGTATCTCGAGATACGCCTTCTTGATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-773s1c1
Sequence:CCGGGCAGCTGAAGTCAGTCACAATCTCGAGATTGTGACTGACTTCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-363s1c1
Sequence:CCGGCGGGAGATTTACGACCGCTATCTCGAGATAGCGGTCGTAAATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-1155s21c1
Sequence:CCGGAGCAACCAAACGCAGTCCATCCTCGAGGATGGACTGCGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-728s21c1
Sequence:CCGGTTCGCTCTGTTTCTACATCTACTCGAGTAGATGTAGAAACAGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-682s21c1
Sequence:CCGGGATTTCTCCTCCTCATCTTTCCTCGAGGAAAGATGAGGAGGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-1033s21c1
Sequence:CCGGATGGAGGCAGCTGGGAAGAAACTCGAGTTTCTTCCCAGCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006736.5-2079s21c1
Sequence:CCGGTACTGCTTCCCTACCACAAATCTCGAGATTTGTGGTAGGGAAGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006736
VALIDATED
DNAJB2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-2398s1c1
Sequence:CCGGCCGGCCTCATTTCTGATAGATCTCGAGATCTATCAGAAATGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006736.4-228s1c1
Sequence:CCGGGATGACATCAAGAAGGCGTATCTCGAGATACGCCTTCTTGATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-773s1c1
Sequence:CCGGGCAGCTGAAGTCAGTCACAATCTCGAGATTGTGACTGACTTCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006736.4-363s1c1
Sequence:CCGGCGGGAGATTTACGACCGCTATCTCGAGATAGCGGTCGTAAATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-1155s21c1
Sequence:CCGGAGCAACCAAACGCAGTCCATCCTCGAGGATGGACTGCGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006736.5-728s21c1
Sequence:CCGGTTCGCTCTGTTTCTACATCTACTCGAGTAGATGTAGAAACAGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-682s21c1
Sequence:CCGGGATTTCTCCTCCTCATCTTTCCTCGAGGAAAGATGAGGAGGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006736.5-1033s21c1
Sequence:CCGGATGGAGGCAGCTGGGAAGAAACTCGAGTTTCTTCCCAGCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006736.5-2079s21c1
Sequence:CCGGTACTGCTTCCCTACCACAAATCTCGAGATTTGTGGTAGGGAAGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks