EMAIL THIS PAGE TO A FRIEND

DNAJB4

DnaJ (Hsp40) homolog, subfamily B, member 4

Synonyms: DNAJW DjB4 HLJ1
UniProtKB ID: Q9UDY4, B2R824, Q13431
Gene ID:
Human(11080) Summary: DNAJB4 belongs to the evolutionarily conserved DNAJ/HSP40 protein family. For background information on the DNAJ family, see MIM 608375.[supplied by OMIM, Mar 2008]
Mouse(67035) DnaJ (Hsp40) homolog, subfamily B, member 4
Rat(295549) DnaJ (Hsp40) homolog, subfamily B, member 4
Zebrafish(445061) DnaJ (Hsp40) homolog, subfamily B, member 4
chicken(424550) DnaJ (Hsp40) homolog, subfamily B, member 4
dog(479982) DnaJ (Hsp40) homolog, subfamily B, member 4
cow(541274) DnaJ (Hsp40) homolog, subfamily B, member 4
domestic cat(101093123) DnaJ (Hsp40) homolog, subfamily B, member 4
sheep(101101935) DnaJ (Hsp40) homolog, subfamily B, member 4
domestic guinea pig(100714263) DnaJ (Hsp40) homolog, subfamily B, member 4
naked mole-rat(101699288) DnaJ (Hsp40) homolog, subfamily B, member 4
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007034 Rosetta Predictions human pricing
NM_001013076 Rosetta Predictions rat pricing
NM_025926 Rosetta Predictions mouse pricing
NM_027287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145453 predicted 307
2 SASI_Hs01_00145454 predicted 1224
3 SASI_Hs01_00145455 predicted 417
4 SASI_Hs01_00145456 predicted 989
5 SASI_Hs01_00145457 predicted 261
6 SASI_Hs01_00145458 predicted 309
7 SASI_Hs01_00145459 predicted 982
8 SASI_Hs01_00145460 predicted 1224
9 SASI_Hs02_00342813 predicted 527
10 SASI_Hs01_00145461 predicted 1237
11 SASI_Hs01_00145462 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095970 predicted 970
2 SASI_Rn02_00200706 predicted 793
3 SASI_Rn01_00095971 predicted 862
4 SASI_Rn01_00095972 predicted 1224
5 SASI_Rn01_00095973 predicted 1176
6 SASI_Rn01_00095974 predicted 1130
7 SASI_Rn02_00200707 predicted 921
8 SASI_Rn01_00095975 predicted 498
9 SASI_Rn01_00095977 predicted 551
10 SASI_Rn01_00095978 predicted 439
11 SASI_Rn01_00095976 predicted 1016
12 SASI_Rn01_00095979 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329286 predicted 498
2 SASI_Mm01_00059760 predicted 908
3 SASI_Mm02_00329287 predicted 1207
4 SASI_Mm02_00329288 predicted 1048
5 SASI_Mm02_00329289 predicted 627
6 SASI_Mm02_00329290 predicted 1329
7 SASI_Mm02_00329291 predicted 991
8 SASI_Mm02_00329292 predicted 605
9 SASI_Mm02_00329293 predicted 782
10 SASI_Mm02_00329294 predicted 1125
11 SASI_Mm01_00059756 predicted 848
12 SASI_Mm01_00059757 predicted 828
13 SASI_Mm01_00059758 predicted 914
14 SASI_Mm01_00059759 predicted 887
15 SASI_Mm01_00059761 predicted 879
16 SASI_Mm01_00059762 predicted 907
17 SASI_Mm01_00059763 predicted 882
18 SASI_Mm01_00059764 predicted 917
19 SASI_Mm01_00059765 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331875 predicted 740
2 SASI_Mm01_00038046 predicted 1149
3 SASI_Mm02_00331876 predicted 1448
4 SASI_Mm02_00331877 predicted 1290
5 SASI_Mm02_00331878 predicted 869
6 SASI_Mm02_00331879 predicted 1569
7 SASI_Mm02_00331880 predicted 1230
8 SASI_Mm02_00331881 predicted 845
9 SASI_Mm02_00331882 predicted 1027
10 SASI_Mm02_00331883 predicted 1364
11 SASI_Mm01_00038042 predicted 957
12 SASI_Mm01_00038043 predicted 942
13 SASI_Mm01_00038044 predicted 1029
14 SASI_Mm01_00038045 predicted 990
15 SASI_Mm01_00038047 predicted 993
16 SASI_Mm01_00038048 predicted 1016
17 SASI_Mm01_00038049 predicted 997
18 SASI_Mm01_00038050 predicted 1025
19 SASI_Mm01_00038051 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007034
VALIDATED
DNAJB4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-316s21c1
Sequence:CCGGGAAGTATTGAGTGATCCTAAACTCGAGTTTAGGATCACTCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-200s1c1
Sequence:CCGGGAGCTTCAGATGAAGATATTACTCGAGTAATATCTTCATCTGAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-620s1c1
Sequence:CCGGTCAAACAAGATCCTCCAGTTACTCGAGTAACTGGAGGATCTTGTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-243s1c1
Sequence:CCGGCCTCAAATTTCATCCGGACAACTCGAGTTGTCCGGATGAAATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1078s1c1
Sequence:CCGGCGTGGTGACCTTCTAATAGAACTCGAGTTCTATTAGAAGGTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1311s1c1
Sequence:CCGGCGGGTCAAATAAATAGGCAAACTCGAGTTTGCCTATTTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-655s21c1
Sequence:CCGGGTATCACTTGAAGAGATATATCTCGAGATATATCTCTTCAAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007034
VALIDATED
DNAJB4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-316s21c1
Sequence:CCGGGAAGTATTGAGTGATCCTAAACTCGAGTTTAGGATCACTCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-200s1c1
Sequence:CCGGGAGCTTCAGATGAAGATATTACTCGAGTAATATCTTCATCTGAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-620s1c1
Sequence:CCGGTCAAACAAGATCCTCCAGTTACTCGAGTAACTGGAGGATCTTGTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-243s1c1
Sequence:CCGGCCTCAAATTTCATCCGGACAACTCGAGTTGTCCGGATGAAATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1078s1c1
Sequence:CCGGCGTGGTGACCTTCTAATAGAACTCGAGTTCTATTAGAAGGTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1311s1c1
Sequence:CCGGCGGGTCAAATAAATAGGCAAACTCGAGTTTGCCTATTTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-655s21c1
Sequence:CCGGGTATCACTTGAAGAGATATATCTCGAGATATATCTCTTCAAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007034
VALIDATED
DNAJB4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-316s21c1
Sequence:CCGGGAAGTATTGAGTGATCCTAAACTCGAGTTTAGGATCACTCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-200s1c1
Sequence:CCGGGAGCTTCAGATGAAGATATTACTCGAGTAATATCTTCATCTGAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-620s1c1
Sequence:CCGGTCAAACAAGATCCTCCAGTTACTCGAGTAACTGGAGGATCTTGTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007034.3-243s1c1
Sequence:CCGGCCTCAAATTTCATCCGGACAACTCGAGTTGTCCGGATGAAATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1078s1c1
Sequence:CCGGCGTGGTGACCTTCTAATAGAACTCGAGTTCTATTAGAAGGTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007034.3-1311s1c1
Sequence:CCGGCGGGTCAAATAAATAGGCAAACTCGAGTTTGCCTATTTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007034.3-655s21c1
Sequence:CCGGGTATCACTTGAAGAGATATATCTCGAGATATATCTCTTCAAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025926
DNAJB4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000112230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025926.1-1766s1c1
Sequence:CCGGGCATGGTTGTAATGTTCGTAACTCGAGTTACGAACATTACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-643s1c1
Sequence:CCGGCCTCCCATTATTCATGAACTTCTCGAGAAGTTCATGAATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-524s1c1
Sequence:CCGGGAGGTCGAGATTCTGAAGAAACTCGAGTTTCTTCAGAATCTCGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-978s1c1
Sequence:CCGGGCCAACAATGGACGGAAGAAACTCGAGTTTCTTCCGTCCATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025926
DNAJB4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000112230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025926.1-1766s1c1
Sequence:CCGGGCATGGTTGTAATGTTCGTAACTCGAGTTACGAACATTACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-643s1c1
Sequence:CCGGCCTCCCATTATTCATGAACTTCTCGAGAAGTTCATGAATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-524s1c1
Sequence:CCGGGAGGTCGAGATTCTGAAGAAACTCGAGTTTCTTCAGAATCTCGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-978s1c1
Sequence:CCGGGCCAACAATGGACGGAAGAAACTCGAGTTTCTTCCGTCCATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025926
DNAJB4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000112230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025926.1-1766s1c1
Sequence:CCGGGCATGGTTGTAATGTTCGTAACTCGAGTTACGAACATTACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-643s1c1
Sequence:CCGGCCTCCCATTATTCATGAACTTCTCGAGAAGTTCATGAATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-524s1c1
Sequence:CCGGGAGGTCGAGATTCTGAAGAAACTCGAGTTTCTTCAGAATCTCGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025926.1-978s1c1
Sequence:CCGGGCCAACAATGGACGGAAGAAACTCGAGTTTCTTCCGTCCATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks