EMAIL THIS PAGE TO A FRIEND

DNAJB5

DnaJ (Hsp40) homolog, subfamily B, member 5

339 Gene Product Result for
Synonyms: Hsc40
Gene ID:
Human(25822) Summary: DNAJB5 belongs to the evolutionarily conserved DNAJ/HSP40 protein family. For background information on the DNAJ family, see MIM 608375.[supplied by OMIM, Mar 2008]
Mouse(56323) DnaJ (Hsp40) homolog, subfamily B, member 5
Rat(313811) DnaJ (Hsp40) homolog, subfamily B, member 5
naked mole-rat(101710596) DnaJ (Hsp40) homolog, subfamily B, member 5
domestic guinea pig(100727398) DnaJ (Hsp40) homolog, subfamily B, member 5
sheep(101119367) DnaJ (Hsp40) homolog, subfamily B, member 5
Zebrafish(569466) DnaJ (Hsp40) homolog, subfamily B, member 5
chicken(427409) DnaJ (Hsp40) homolog, subfamily B, member 5
dog(474753) DnaJ (Hsp40) homolog, subfamily B, member 5
cow(540083) DnaJ (Hsp40) homolog, subfamily B, member 5
Horse(100068284) DnaJ (Hsp40) homolog, subfamily B, member 5
domestic cat(101088032) DnaJ (Hsp40) homolog, subfamily B, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012266 Rosetta Predictions human pricing
NM_001108004 Rosetta Predictions rat pricing
NM_019874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144427 predicted 1737
2 SASI_Hs01_00144428 predicted 947
3 SASI_Hs01_00144429 predicted 1723
4 SASI_Hs01_00144430 predicted 368
5 SASI_Hs01_00144431 predicted 296
6 SASI_Hs01_00144432 predicted 899
7 SASI_Hs01_00144433 predicted 596
8 SASI_Hs01_00144434 predicted 1049
9 SASI_Hs01_00144435 predicted 689
10 SASI_Hs01_00144436 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234415 predicted 378
2 SASI_Rn02_00234416 predicted 1284
3 SASI_Rn02_00234417 predicted 1006
4 SASI_Rn02_00234418 predicted 254
5 SASI_Rn02_00234419 predicted 1169
6 SASI_Rn02_00234420 predicted 984
7 SASI_Rn02_00234421 predicted 475
8 SASI_Rn02_00234422 predicted 1146
9 SASI_Rn02_00234423 predicted 1022
10 SASI_Rn02_00234424 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163767 predicted 1054
2 SASI_Mm01_00163768 predicted 924
3 SASI_Mm01_00163769 predicted 935
4 SASI_Mm01_00163770 predicted 800
5 SASI_Mm01_00163771 predicted 784
6 SASI_Mm01_00163772 predicted 782
7 SASI_Mm01_00163773 predicted 251
8 SASI_Mm01_00163774 predicted 668
9 SASI_Mm02_00325179 predicted 761
10 SASI_Mm01_00163776 predicted 733
11 SASI_Mm01_00163775 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012266
DNAJB5 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1423s21c1
Sequence:CCGGACTAGCTTTCAATCCAGTTTCCTCGAGGAAACTGGATTGAAAGCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1634s21c1
Sequence:CCGGGTCCACAGTGTCCAAGGTAATCTCGAGATTACCTTGGACACTGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012266.4-389s21c1
Sequence:CCGGGCTCCTTTCACTACACCTTTCCTCGAGGAAAGGTGTAGTGAAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012266.2-2269s1c1
Sequence:CCGGCCATAGTTGTATAAAGGTCATCTCGAGATGACCTTTATACAACTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-846s1c1
Sequence:CCGGGAGGACAAGATCCTGCACATACTCGAGTATGTGCAGGATCTTGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-343s1c1
Sequence:CCGGCCAACGCTGAGGAGAAGTTTACTCGAGTAAACTTCTCCTCAGCGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1097s1c1
Sequence:CCGGGCCCTGCAATGATGTCATCAACTCGAGTTGATGACATCATTGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1230s1c1
Sequence:CCGGCCACAGACAAGACAGATCCTTCTCGAGAAGGATCTGTCTTGTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012266
DNAJB5 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1423s21c1
Sequence:CCGGACTAGCTTTCAATCCAGTTTCCTCGAGGAAACTGGATTGAAAGCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1634s21c1
Sequence:CCGGGTCCACAGTGTCCAAGGTAATCTCGAGATTACCTTGGACACTGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012266.4-389s21c1
Sequence:CCGGGCTCCTTTCACTACACCTTTCCTCGAGGAAAGGTGTAGTGAAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012266.2-2269s1c1
Sequence:CCGGCCATAGTTGTATAAAGGTCATCTCGAGATGACCTTTATACAACTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-846s1c1
Sequence:CCGGGAGGACAAGATCCTGCACATACTCGAGTATGTGCAGGATCTTGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-343s1c1
Sequence:CCGGCCAACGCTGAGGAGAAGTTTACTCGAGTAAACTTCTCCTCAGCGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1097s1c1
Sequence:CCGGGCCCTGCAATGATGTCATCAACTCGAGTTGATGACATCATTGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1230s1c1
Sequence:CCGGCCACAGACAAGACAGATCCTTCTCGAGAAGGATCTGTCTTGTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012266
DNAJB5 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1423s21c1
Sequence:CCGGACTAGCTTTCAATCCAGTTTCCTCGAGGAAACTGGATTGAAAGCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012266.4-1634s21c1
Sequence:CCGGGTCCACAGTGTCCAAGGTAATCTCGAGATTACCTTGGACACTGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012266.4-389s21c1
Sequence:CCGGGCTCCTTTCACTACACCTTTCCTCGAGGAAAGGTGTAGTGAAAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012266.2-2269s1c1
Sequence:CCGGCCATAGTTGTATAAAGGTCATCTCGAGATGACCTTTATACAACTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-846s1c1
Sequence:CCGGGAGGACAAGATCCTGCACATACTCGAGTATGTGCAGGATCTTGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-343s1c1
Sequence:CCGGCCAACGCTGAGGAGAAGTTTACTCGAGTAAACTTCTCCTCAGCGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1097s1c1
Sequence:CCGGGCCCTGCAATGATGTCATCAACTCGAGTTGATGACATCATTGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012266.2-1230s1c1
Sequence:CCGGCCACAGACAAGACAGATCCTTCTCGAGAAGGATCTGTCTTGTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019874
VALIDATED
DNAJB5 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-198s21c1
Sequence:CCGGCAACGCCGAGGAGAAGTTTAACTCGAGTTAAACTTCTCCTCGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-910s21c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-814s21c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-262s21c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019874.3-1403s21c1
Sequence:CCGGTGAGAGCTACTCGGAGCTATACTCGAGTATAGCTCCGAGTAGCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-1683s1c1
Sequence:CCGGCCTGTGAACAAGGCTGTTCTTCTCGAGAAGAACAGCCTTGTTCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019874.3-367s1c1
Sequence:CCGGGCCACCTTTGCTTCCTTCTTTCTCGAGAAAGAAGGAAGCAAAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-910s1c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-262s1c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-814s1c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019874
VALIDATED
DNAJB5 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-198s21c1
Sequence:CCGGCAACGCCGAGGAGAAGTTTAACTCGAGTTAAACTTCTCCTCGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-910s21c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-814s21c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-262s21c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019874.3-1403s21c1
Sequence:CCGGTGAGAGCTACTCGGAGCTATACTCGAGTATAGCTCCGAGTAGCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-1683s1c1
Sequence:CCGGCCTGTGAACAAGGCTGTTCTTCTCGAGAAGAACAGCCTTGTTCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019874.3-367s1c1
Sequence:CCGGGCCACCTTTGCTTCCTTCTTTCTCGAGAAAGAAGGAAGCAAAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-910s1c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-262s1c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-814s1c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019874
VALIDATED
DNAJB5 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-198s21c1
Sequence:CCGGCAACGCCGAGGAGAAGTTTAACTCGAGTTAAACTTCTCCTCGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-910s21c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-814s21c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019874.3-262s21c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019874.3-1403s21c1
Sequence:CCGGTGAGAGCTACTCGGAGCTATACTCGAGTATAGCTCCGAGTAGCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-1683s1c1
Sequence:CCGGCCTGTGAACAAGGCTGTTCTTCTCGAGAAGAACAGCCTTGTTCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019874.3-367s1c1
Sequence:CCGGGCCACCTTTGCTTCCTTCTTTCTCGAGAAAGAAGGAAGCAAAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-910s1c1
Sequence:CCGGACCGTGAACATTCCCACCATTCTCGAGAATGGTGGGAATGTTCACGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-262s1c1
Sequence:CCGGCGGAGCCTGTACGACCAGTATCTCGAGATACTGGTCGTACAGGCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019874.3-814s1c1
Sequence:CCGGGTGCTCAAAGACAAGCCTCATCTCGAGATGAGGCTTGTCTTTGAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)