EMAIL THIS PAGE TO A FRIEND

DNAJB6

DnaJ (Hsp40) homolog, subfamily B, member 6

169 Gene Product Result for
Synonyms: DJ4 DnaJ HHDJ1 HSJ-2 HSJ2 LGMD1E MRJ MSJ-1
Gene ID:
Human(10049) Summary: This gene encodes a member of the DNAJ protein family. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. This family member may also play a role in polyglutamine aggregation in specific neurons. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(23950) DnaJ (Hsp40) homolog, subfamily B, member 6
Rat(362293) DnaJ (Hsp40) homolog, subfamily B, member 6
chicken(420448) DnaJ (Hsp40) homolog, subfamily B, member 6
cow(282215) DnaJ (Hsp40) homolog, subfamily B, member 6
dog(608937) DnaJ (Hsp40) homolog, subfamily B, member 6
domestic guinea pig(100713928) DnaJ (Hsp40) homolog, subfamily B, member 6
naked mole-rat(101716904) DnaJ (Hsp40) homolog, subfamily B, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005494 Rosetta Predictions human pricing
NM_058246 Rosetta Predictions human pricing
NM_001013209 Rosetta Predictions rat pricing
NM_001037940 Rosetta Predictions mouse pricing
NM_001037941 Rosetta Predictions mouse pricing
NM_001127367 Rosetta Predictions mouse pricing
NM_011847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212271 predicted 351
2 SASI_Hs01_00212272 predicted 230
3 SASI_Hs01_00212273 predicted 509
4 SASI_Hs01_00212274 predicted 310
5 SASI_Hs01_00212275 predicted 326
6 SASI_Hs02_00339690 predicted 224
7 SASI_Hs01_00212276 predicted 211
8 SASI_Hs01_00212277 predicted 416
9 SASI_Hs01_00212278 predicted 513
10 SASI_Hs01_00212279 predicted 577
11 SASI_Hs01_00212280 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047921 predicted 624
2 SASI_Hs01_00047922 predicted 350
3 SASI_Hs01_00047923 predicted 229
4 SASI_Hs01_00047924 predicted 509
5 SASI_Hs01_00047925 predicted 305
6 SASI_Hs01_00047926 predicted 329
7 SASI_Hs01_00047927 predicted 230
8 SASI_Hs01_00047928 predicted 209
9 SASI_Hs01_00047929 predicted 417
10 SASI_Hs01_00047930 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073946 predicted 1493
2 SASI_Rn01_00073947 predicted 1496
3 SASI_Rn01_00073948 predicted 1652
4 SASI_Rn01_00073950 predicted 1374
5 SASI_Rn01_00073951 predicted 454
6 SASI_Rn01_00073952 predicted 1660
7 SASI_Rn01_00073953 predicted 1684
8 SASI_Rn01_00073954 predicted 1623
9 SASI_Rn02_00200999 predicted 272
10 SASI_Rn02_00201000 predicted 400
11 SASI_Rn01_00073949 predicted 1628
12 SASI_Rn01_00073955 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289545 predicted 358
2 SASI_Mm02_00289546 predicted 363
3 SASI_Mm02_00289547 predicted 365
4 SASI_Mm02_00289548 predicted 363
5 SASI_Mm02_00289549 predicted 278
6 SASI_Mm02_00289550 predicted 366
7 SASI_Mm02_00289551 predicted 367
8 SASI_Mm02_00289552 predicted 276
9 SASI_Mm02_00289553 predicted 282
10 SASI_Mm02_00289554 predicted 364
11 SASI_Mm01_00139969 predicted 280
12 SASI_Mm01_00139970 predicted 616
13 SASI_Mm01_00139971 predicted 420
14 SASI_Mm01_00139972 predicted 708
15 SASI_Mm01_00139973 predicted 318
16 SASI_Mm01_00139974 predicted 309
17 SASI_Mm01_00139975 predicted 314
18 SASI_Mm01_00139976 predicted 681
19 SASI_Mm01_00139977 predicted 604
20 SASI_Mm01_00139978 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289555 predicted 357
2 SASI_Mm02_00289556 predicted 358
3 SASI_Mm02_00289557 predicted 370
4 SASI_Mm02_00289558 predicted 367
5 SASI_Mm02_00289559 predicted 281
6 SASI_Mm02_00289560 predicted 360
7 SASI_Mm02_00289561 predicted 369
8 SASI_Mm02_00289562 predicted 284
9 SASI_Mm02_00289563 predicted 279
10 SASI_Mm02_00289564 predicted 360
11 SASI_Mm01_00193011 predicted 741
12 SASI_Mm01_00193012 predicted 578
13 SASI_Mm01_00193013 predicted 637
14 SASI_Mm01_00193014 predicted 560
15 SASI_Mm01_00193015 predicted 565
16 SASI_Mm01_00193016 predicted 727
17 SASI_Mm01_00193017 predicted 590
18 SASI_Mm01_00193018 predicted 627
19 SASI_Mm01_00193019 predicted 621
20 SASI_Mm01_00193020 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310357 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321581 predicted 363
2 SASI_Mm02_00321582 predicted 358
3 SASI_Mm02_00321583 predicted 363
4 SASI_Mm02_00321584 predicted 362
5 SASI_Mm02_00321585 predicted 280
6 SASI_Mm02_00321586 predicted 365
7 SASI_Mm02_00321587 predicted 366
8 SASI_Mm02_00321588 predicted 277
9 SASI_Mm02_00321589 predicted 278
10 SASI_Mm02_00321590 predicted 359
11 SASI_Mm01_00056987 predicted 289
12 SASI_Mm01_00056988 predicted 478
13 SASI_Mm01_00056989 predicted 1312
14 SASI_Mm01_00056990 predicted 1319
15 SASI_Mm01_00056991 predicted 369
16 SASI_Mm01_00056992 predicted 1257
17 SASI_Mm01_00056993 predicted 689
18 SASI_Mm01_00056994 predicted 492
19 SASI_Mm01_00056995 predicted 1281
20 SASI_Mm01_00056996 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005494
VALIDATED
DNAJB6 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005494.2-891s1c1
Sequence:CCGGCGCACTTAACAGAAATGTTAACTCGAGTTAACATTTCTGTTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-583s1c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-195s1c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005494.2-821s1c1
Sequence:CCGGCCAGTTAAAGTCCTTAACAATCTCGAGATTGTTAAGGACTTTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005494.2-339s1c1
Sequence:CCGGCGGGACATCTATGACAAATATCTCGAGATATTTGTCATAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-583s21c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005494.2-1049s21c1
Sequence:CCGGTGATTGTTGGGACCACATAATCTCGAGATTATGTGGTCCCAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-675s21c1
Sequence:CCGGTCATTCTCTTCCACGTCATTTCTCGAGAAATGACGTGGAAGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-195s21c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005494.2-723s21c1
Sequence:CCGGTCGATATCAACTTCAACTAAACTCGAGTTTAGTTGAAGTTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005494
VALIDATED
DNAJB6 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005494.2-891s1c1
Sequence:CCGGCGCACTTAACAGAAATGTTAACTCGAGTTAACATTTCTGTTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-583s1c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-195s1c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005494.2-821s1c1
Sequence:CCGGCCAGTTAAAGTCCTTAACAATCTCGAGATTGTTAAGGACTTTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005494.2-339s1c1
Sequence:CCGGCGGGACATCTATGACAAATATCTCGAGATATTTGTCATAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-583s21c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005494.2-1049s21c1
Sequence:CCGGTGATTGTTGGGACCACATAATCTCGAGATTATGTGGTCCCAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-675s21c1
Sequence:CCGGTCATTCTCTTCCACGTCATTTCTCGAGAAATGACGTGGAAGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-195s21c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005494.2-723s21c1
Sequence:CCGGTCGATATCAACTTCAACTAAACTCGAGTTTAGTTGAAGTTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005494
VALIDATED
DNAJB6 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005494.2-891s1c1
Sequence:CCGGCGCACTTAACAGAAATGTTAACTCGAGTTAACATTTCTGTTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-583s1c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005494.2-195s1c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005494.2-821s1c1
Sequence:CCGGCCAGTTAAAGTCCTTAACAATCTCGAGATTGTTAAGGACTTTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005494.2-339s1c1
Sequence:CCGGCGGGACATCTATGACAAATATCTCGAGATATTTGTCATAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-583s21c1
Sequence:CCGGCGTTCAGTGGATTTCCGTCTTCTCGAGAAGACGGAAATCCACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005494.2-1049s21c1
Sequence:CCGGTGATTGTTGGGACCACATAATCTCGAGATTATGTGGTCCCAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-675s21c1
Sequence:CCGGTCATTCTCTTCCACGTCATTTCTCGAGAAATGACGTGGAAGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005494.2-195s21c1
Sequence:CCGGGCCTCACCCGAGGATATTAAACTCGAGTTTAATATCCTCGGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005494.2-723s21c1
Sequence:CCGGTCGATATCAACTTCAACTAAACTCGAGTTTAGTTGAAGTTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011847
VALIDATED
DNAJB6 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-185s1c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011847.1-823s1c1
Sequence:CCGGGCCCTTGACAATAAATGGTAACTCGAGTTACCATTTATTGTCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-434s1c1
Sequence:CCGGCCAGATGATGTCTTCAGGGAACTCGAGTTCCCTGAAGACATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-329s1c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011847.1-1271s1c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-429s21c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011847.4-1371s21c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-285s21c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-972s21c1
Sequence:CCGGTAACTCAACGCACGCATTTAACTCGAGTTAAATGCGTGCGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011847
VALIDATED
DNAJB6 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-185s1c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011847.1-823s1c1
Sequence:CCGGGCCCTTGACAATAAATGGTAACTCGAGTTACCATTTATTGTCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-434s1c1
Sequence:CCGGCCAGATGATGTCTTCAGGGAACTCGAGTTCCCTGAAGACATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-329s1c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011847.1-1271s1c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-429s21c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011847.4-1371s21c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-285s21c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-972s21c1
Sequence:CCGGTAACTCAACGCACGCATTTAACTCGAGTTAAATGCGTGCGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011847
VALIDATED
DNAJB6 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-185s1c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011847.1-823s1c1
Sequence:CCGGGCCCTTGACAATAAATGGTAACTCGAGTTACCATTTATTGTCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-434s1c1
Sequence:CCGGCCAGATGATGTCTTCAGGGAACTCGAGTTCCCTGAAGACATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011847.1-329s1c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011847.1-1271s1c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-429s21c1
Sequence:CCGGCGGGACATCTACGACAAATATCTCGAGATATTTGTCGTAGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011847.4-1371s21c1
Sequence:CCGGGCCAGATGAATCTACAGAAATCTCGAGATTTCTGTAGATTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-285s21c1
Sequence:CCGGGCCTCACCTGAGGACATTAAACTCGAGTTTAATGTCCTCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011847.4-972s21c1
Sequence:CCGGTAACTCAACGCACGCATTTAACTCGAGTTAAATGCGTGCGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks