EMAIL THIS PAGE TO A FRIEND

DNAJB7

DnaJ (Hsp40) homolog, subfamily B, member 7

Synonyms: DJ5 HSC3
UniProtKB ID: Q7Z6W7, Q2M220, Q5H904, Q8WYJ7
Gene ID:
Human(150353) Summary: The protein encoded by this intronless gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain.[provided by RefSeq, Mar 2011]
Mouse(57755) DnaJ (Hsp40) homolog, subfamily B, member 7
Rat(685839) DnaJ (Hsp40) homolog, subfamily B, member 7
dog(474495) DnaJ (Hsp40) homolog, subfamily B, member 7
domestic cat(101087498) DnaJ (Hsp40) homolog, subfamily B, member 7
cow(789037) DnaJ (Hsp40) homolog, subfamily B, member 7
naked mole-rat(101713214) DnaJ (Hsp40) homolog, subfamily B, member 7
sheep(101109607) DnaJ (Hsp40) homolog, subfamily B, member 7
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145174 Rosetta Predictions human pricing
NM_001130510 Rosetta Predictions rat pricing
NM_021317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180417 predicted 202
2 SASI_Hs01_00180419 predicted 470
3 SASI_Hs01_00180420 predicted 380
4 SASI_Hs01_00180421 predicted 277
5 SASI_Hs01_00180422 predicted 485
6 SASI_Hs01_00180423 predicted 295
7 SASI_Hs01_00180424 predicted 701
8 SASI_Hs01_00180425 predicted 714
9 SASI_Hs01_00180426 predicted 516
10 SASI_Hs02_00365031 predicted 671
11 SASI_Hs01_00180418 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255529 predicted 212
2 SASI_Rn02_00255530 predicted 774
3 SASI_Rn02_00255531 predicted 856
4 SASI_Rn02_00255532 predicted 711
5 SASI_Rn02_00255533 predicted 291
6 SASI_Rn02_00255534 predicted 865
7 SASI_Rn02_00255535 predicted 385
8 SASI_Rn02_00255536 predicted 579
9 SASI_Rn02_00255537 predicted 685
10 SASI_Rn02_00255538 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056738 predicted 213
2 SASI_Mm01_00056739 predicted 383
3 SASI_Mm01_00056740 predicted 771
4 SASI_Mm01_00056742 predicted 721
5 SASI_Mm01_00056743 predicted 592
6 SASI_Mm02_00325868 predicted 711
7 SASI_Mm01_00056744 predicted 302
8 SASI_Mm01_00056745 predicted 857
9 SASI_Mm02_00325869 predicted 691
10 SASI_Mm02_00325870 predicted 420
11 SASI_Mm01_00056737 predicted 706
12 SASI_Mm01_00056741 predicted 796
13 SASI_Mm01_00056746 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021317
DNAJB7 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-179s21c1
Sequence:CCGGGCGTCACCAGAAGACATTAAACTCGAGTTTAATGTCTTCTGGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-635s21c1
Sequence:CCGGCATGAGGGCCTTACGTCATTCCTCGAGGAATGACGTAAGGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021317.1-902s1c1
Sequence:CCGGGCTCCTCAAATACAACTCAATCTCGAGATTGAGTTGTATTTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-203s1c1
Sequence:CCGGGCTTATCGTAAAGTAGCACTTCTCGAGAAGTGCTACTTTACGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-419s1c1
Sequence:CCGGGCAGACGATGTCTTTAAGGAACTCGAGTTCCTTAAAGACATCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-606s1c1
Sequence:CCGGCAGGGTATTCATCTTATGTTTCTCGAGAAACATAAGATGAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-765s1c1
Sequence:CCGGCCGTCAAGAAAGAGAAGCTGACTCGAGTCAGCTTCTCTTTCTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021317
DNAJB7 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-179s21c1
Sequence:CCGGGCGTCACCAGAAGACATTAAACTCGAGTTTAATGTCTTCTGGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-635s21c1
Sequence:CCGGCATGAGGGCCTTACGTCATTCCTCGAGGAATGACGTAAGGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021317.1-902s1c1
Sequence:CCGGGCTCCTCAAATACAACTCAATCTCGAGATTGAGTTGTATTTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-203s1c1
Sequence:CCGGGCTTATCGTAAAGTAGCACTTCTCGAGAAGTGCTACTTTACGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-419s1c1
Sequence:CCGGGCAGACGATGTCTTTAAGGAACTCGAGTTCCTTAAAGACATCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-606s1c1
Sequence:CCGGCAGGGTATTCATCTTATGTTTCTCGAGAAACATAAGATGAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-765s1c1
Sequence:CCGGCCGTCAAGAAAGAGAAGCTGACTCGAGTCAGCTTCTCTTTCTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021317
DNAJB7 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-179s21c1
Sequence:CCGGGCGTCACCAGAAGACATTAAACTCGAGTTTAATGTCTTCTGGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021317.2-635s21c1
Sequence:CCGGCATGAGGGCCTTACGTCATTCCTCGAGGAATGACGTAAGGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021317.1-902s1c1
Sequence:CCGGGCTCCTCAAATACAACTCAATCTCGAGATTGAGTTGTATTTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-203s1c1
Sequence:CCGGGCTTATCGTAAAGTAGCACTTCTCGAGAAGTGCTACTTTACGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-419s1c1
Sequence:CCGGGCAGACGATGTCTTTAAGGAACTCGAGTTCCTTAAAGACATCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-606s1c1
Sequence:CCGGCAGGGTATTCATCTTATGTTTCTCGAGAAACATAAGATGAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021317.1-765s1c1
Sequence:CCGGCCGTCAAGAAAGAGAAGCTGACTCGAGTCAGCTTCTCTTTCTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145174
DNAJB7 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-211s1c1
Sequence:CCGGGCACTTAAATGGCACCCTGATCTCGAGATCAGGGTGCCATTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-280s1c1
Sequence:CCGGGCTGAGGCATACGAGGTATTACTCGAGTAATACCTCGTATGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1558s1c1
Sequence:CCGGCCACTATACAAACTTACGAAACTCGAGTTTCGTAAGTTTGTATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1587s1c1
Sequence:CCGGGCATTAGAAGACAAGAATGTACTCGAGTACATTCTTGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-2364s1c1
Sequence:CCGGGCCAAATACAAATGCGAAATTCTCGAGAATTTCGCATTTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-802s1c1
Sequence:CCGGGTAAATAGTGTGGCCAATGAACTCGAGTTCATTGGCCACACTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-907s1c1
Sequence:CCGGCAATATACTTTCGTGGACAATCTCGAGATTGTCCACGAAAGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145174.1-1226s1c1
Sequence:CCGGGATGAGTTTGTGGTGACAGTTCTCGAGAACTGTCACCACAAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145174
DNAJB7 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-211s1c1
Sequence:CCGGGCACTTAAATGGCACCCTGATCTCGAGATCAGGGTGCCATTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-280s1c1
Sequence:CCGGGCTGAGGCATACGAGGTATTACTCGAGTAATACCTCGTATGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1558s1c1
Sequence:CCGGCCACTATACAAACTTACGAAACTCGAGTTTCGTAAGTTTGTATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1587s1c1
Sequence:CCGGGCATTAGAAGACAAGAATGTACTCGAGTACATTCTTGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-2364s1c1
Sequence:CCGGGCCAAATACAAATGCGAAATTCTCGAGAATTTCGCATTTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-802s1c1
Sequence:CCGGGTAAATAGTGTGGCCAATGAACTCGAGTTCATTGGCCACACTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-907s1c1
Sequence:CCGGCAATATACTTTCGTGGACAATCTCGAGATTGTCCACGAAAGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145174.1-1226s1c1
Sequence:CCGGGATGAGTTTGTGGTGACAGTTCTCGAGAACTGTCACCACAAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145174
DNAJB7 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-211s1c1
Sequence:CCGGGCACTTAAATGGCACCCTGATCTCGAGATCAGGGTGCCATTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145174.1-280s1c1
Sequence:CCGGGCTGAGGCATACGAGGTATTACTCGAGTAATACCTCGTATGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1558s1c1
Sequence:CCGGCCACTATACAAACTTACGAAACTCGAGTTTCGTAAGTTTGTATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-1587s1c1
Sequence:CCGGGCATTAGAAGACAAGAATGTACTCGAGTACATTCTTGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145174.1-2364s1c1
Sequence:CCGGGCCAAATACAAATGCGAAATTCTCGAGAATTTCGCATTTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-802s1c1
Sequence:CCGGGTAAATAGTGTGGCCAATGAACTCGAGTTCATTGGCCACACTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145174.1-907s1c1
Sequence:CCGGCAATATACTTTCGTGGACAATCTCGAGATTGTCCACGAAAGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145174.1-1226s1c1
Sequence:CCGGGATGAGTTTGTGGTGACAGTTCTCGAGAACTGTCACCACAAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks