EMAIL THIS PAGE TO A FRIEND

DNAJB8

DnaJ (Hsp40) homolog, subfamily B, member 8

44 Gene Product Result for
Synonyms: DJ6
UniProtKB ID: Q8NHS0, B3KWV7
Gene ID:
Human(165721) Summary: The protein encoded by this gene belongs to the DNAJ/HSP40 family of proteins that regulate chaperone activity. This family member suppresses aggregation and toxicity of polyglutamine proteins, and the C-terminal tail is essential for this activity. It has been implicated as a cancer-testis antigen and as a cancer stem-like cell antigen involved in renal cell carcinoma. [provided by RefSeq, Jun 2012]
Mouse(56691) DnaJ (Hsp40) homolog, subfamily B, member 8
Rat(500253) DnaJ (Hsp40) homolog, subfamily B, member 8
domestic guinea pig(100721284) DnaJ (Hsp40) homolog, subfamily B, member 8
naked mole-rat(101705202) DnaJ (Hsp40) homolog, subfamily B, member 8
dog(609460) DnaJ (Hsp40) homolog, subfamily B, member 8
cow(518674) DnaJ (Hsp40) homolog, subfamily B, member 8
domestic cat(101088652) DnaJ (Hsp40) homolog, subfamily B, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153330 Rosetta Predictions human pricing
NM_001109248 Rosetta Predictions rat pricing
NM_019964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367179 predicted 2197
2 SASI_Hs01_00104213 predicted 1748
3 SASI_Hs01_00104214 predicted 1943
4 SASI_Hs01_00104215 predicted 2210
5 SASI_Hs01_00104216 predicted 1981
6 SASI_Hs01_00104217 predicted 1829
7 SASI_Hs01_00104218 predicted 2239
8 SASI_Hs01_00104220 predicted 1938
9 SASI_Hs01_00104221 predicted 2059
10 SASI_Hs01_00104222 predicted 1808
11 SASI_Hs01_00104219 predicted 2234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246544 predicted 740
2 SASI_Rn02_00246545 predicted 630
3 SASI_Rn02_00246546 predicted 507
4 SASI_Rn02_00246547 predicted 768
5 SASI_Rn02_00246548 predicted 480
6 SASI_Rn02_00246549 predicted 223
7 SASI_Rn02_00246550 predicted 498
8 SASI_Rn02_00246551 predicted 491
9 SASI_Rn02_00246552 predicted 605
10 SASI_Rn02_00246553 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172064 predicted 490
2 SASI_Mm01_00172065 predicted 476
3 SASI_Mm01_00172066 predicted 361
4 SASI_Mm01_00172067 predicted 367
5 SASI_Mm02_00325264 predicted 287
6 SASI_Mm01_00172068 predicted 489
7 SASI_Mm01_00172069 predicted 735
8 SASI_Mm01_00172070 predicted 224
9 SASI_Mm02_00325265 predicted 762
10 SASI_Mm02_00325266 predicted 370
11 SASI_Mm01_00172071 predicted 229
12 SASI_Mm01_00172072 predicted 344
13 SASI_Mm01_00172073 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019964
DNAJB8 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-375s1c1
Sequence:CCGGCGAAGTCTTGTCAGACTCTAACTCGAGTTAGAGTCTGACAAGACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-322s1c1
Sequence:CCGGCCCGACAACAAAGAAGAAGCTCTCGAGAGCTTCTTCTTTGTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-591s1c1
Sequence:CCGGCCATGGTTTACACAGAGTCTTCTCGAGAAGACTCTGTGTAAACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-796s1c1
Sequence:CCGGCGAATCATTGAGAACGGCCAACTCGAGTTGGCCGTTCTCAATGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-491s1c1
Sequence:CCGGCCTTCCGAAATCCTGAGGATACTCGAGTATCCTCAGGATTTCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-555s21c1
Sequence:CCGGATTCTGGGACACTCCGTTCAGCTCGAGCTGAACGGAGTGTCCCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-643s21c1
Sequence:CCGGATGGAAGCCTTGTCATCTTTCCTCGAGGAAAGATGACAAGGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-345s21c1
Sequence:CCGGGAAGAAGTTTAAGCAGGTTTCCTCGAGGAAACCTGCTTAAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019964
DNAJB8 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-375s1c1
Sequence:CCGGCGAAGTCTTGTCAGACTCTAACTCGAGTTAGAGTCTGACAAGACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-322s1c1
Sequence:CCGGCCCGACAACAAAGAAGAAGCTCTCGAGAGCTTCTTCTTTGTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-591s1c1
Sequence:CCGGCCATGGTTTACACAGAGTCTTCTCGAGAAGACTCTGTGTAAACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-796s1c1
Sequence:CCGGCGAATCATTGAGAACGGCCAACTCGAGTTGGCCGTTCTCAATGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-491s1c1
Sequence:CCGGCCTTCCGAAATCCTGAGGATACTCGAGTATCCTCAGGATTTCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-555s21c1
Sequence:CCGGATTCTGGGACACTCCGTTCAGCTCGAGCTGAACGGAGTGTCCCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-643s21c1
Sequence:CCGGATGGAAGCCTTGTCATCTTTCCTCGAGGAAAGATGACAAGGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-345s21c1
Sequence:CCGGGAAGAAGTTTAAGCAGGTTTCCTCGAGGAAACCTGCTTAAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019964
DNAJB8 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-375s1c1
Sequence:CCGGCGAAGTCTTGTCAGACTCTAACTCGAGTTAGAGTCTGACAAGACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-322s1c1
Sequence:CCGGCCCGACAACAAAGAAGAAGCTCTCGAGAGCTTCTTCTTTGTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-591s1c1
Sequence:CCGGCCATGGTTTACACAGAGTCTTCTCGAGAAGACTCTGTGTAAACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-796s1c1
Sequence:CCGGCGAATCATTGAGAACGGCCAACTCGAGTTGGCCGTTCTCAATGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019964.1-491s1c1
Sequence:CCGGCCTTCCGAAATCCTGAGGATACTCGAGTATCCTCAGGATTTCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-555s21c1
Sequence:CCGGATTCTGGGACACTCCGTTCAGCTCGAGCTGAACGGAGTGTCCCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-643s21c1
Sequence:CCGGATGGAAGCCTTGTCATCTTTCCTCGAGGAAAGATGACAAGGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019964.1-345s21c1
Sequence:CCGGGAAGAAGTTTAAGCAGGTTTCCTCGAGGAAACCTGCTTAAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153330
DNAJB8 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2219s1c1
Sequence:CCGGCGAGATGATCAATGGCCACAACTCGAGTTGTGGCCATTGATCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2013s1c1
Sequence:CCGGCCATTCAATAGTGACCGTGGTCTCGAGACCACGGTCACTATTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1836s1c1
Sequence:CCGGTCCAAGAAACGCTCCCTGTATCTCGAGATACAGGGAGCGTTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1950s1c1
Sequence:CCGGGAGGACATCTTCCGGGAGTTTCTCGAGAAACTCCCGGAAGATGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1758s21c1
Sequence:CCGGGACAAGAACCCTGACAATAAGCTCGAGCTTATTGTCAGGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-2098s21c1
Sequence:CCGGAGGCCTTCTCATCCTTCAACACTCGAGTGTTGAAGGATGAGAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1813s21c1
Sequence:CCGGAGGCCTATGAGGTTCTGTCTGCTCGAGCAGACAGAACCTCATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153330
DNAJB8 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2219s1c1
Sequence:CCGGCGAGATGATCAATGGCCACAACTCGAGTTGTGGCCATTGATCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2013s1c1
Sequence:CCGGCCATTCAATAGTGACCGTGGTCTCGAGACCACGGTCACTATTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1836s1c1
Sequence:CCGGTCCAAGAAACGCTCCCTGTATCTCGAGATACAGGGAGCGTTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1950s1c1
Sequence:CCGGGAGGACATCTTCCGGGAGTTTCTCGAGAAACTCCCGGAAGATGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1758s21c1
Sequence:CCGGGACAAGAACCCTGACAATAAGCTCGAGCTTATTGTCAGGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-2098s21c1
Sequence:CCGGAGGCCTTCTCATCCTTCAACACTCGAGTGTTGAAGGATGAGAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1813s21c1
Sequence:CCGGAGGCCTATGAGGTTCTGTCTGCTCGAGCAGACAGAACCTCATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153330
DNAJB8 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2219s1c1
Sequence:CCGGCGAGATGATCAATGGCCACAACTCGAGTTGTGGCCATTGATCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-2013s1c1
Sequence:CCGGCCATTCAATAGTGACCGTGGTCTCGAGACCACGGTCACTATTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1836s1c1
Sequence:CCGGTCCAAGAAACGCTCCCTGTATCTCGAGATACAGGGAGCGTTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153330.2-1950s1c1
Sequence:CCGGGAGGACATCTTCCGGGAGTTTCTCGAGAAACTCCCGGAAGATGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1758s21c1
Sequence:CCGGGACAAGAACCCTGACAATAAGCTCGAGCTTATTGTCAGGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-2098s21c1
Sequence:CCGGAGGCCTTCTCATCCTTCAACACTCGAGTGTTGAAGGATGAGAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153330.2-1813s21c1
Sequence:CCGGAGGCCTATGAGGTTCTGTCTGCTCGAGCAGACAGAACCTCATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks