EMAIL THIS PAGE TO A FRIEND

DNAJB9

DnaJ (Hsp40) homolog, subfamily B, member 9

106 Gene Product Result for
Synonyms: ERdj4 MDG-1 MDG1 MST049 MSTP049
UniProtKB ID: Q9UBS3
Gene ID:
Human(4189) Summary: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]
Mouse(27362) DnaJ (Hsp40) homolog, subfamily B, member 9
Rat(24908) DnaJ (Hsp40) homolog, subfamily B, member 9
chicken(417783) DnaJ (Hsp40) homolog, subfamily B, member 9
domestic cat(101081880) DnaJ (Hsp40) homolog, subfamily B, member 9
cow(614588) DnaJ (Hsp40) homolog, subfamily B, member 9
dog(475286) DnaJ (Hsp40) homolog, subfamily B, member 9
naked mole-rat(101724252) DnaJ (Hsp40) homolog, subfamily B, member 9
domestic guinea pig(100730275) DnaJ (Hsp40) homolog, subfamily B, member 9
sheep(101113840) DnaJ (Hsp40) homolog, subfamily B, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012328 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055001 MISSION® esiRNA esiRNA human DNAJB9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012328 Rosetta Predictions human pricing
NM_012699 Rosetta Predictions rat pricing
NM_013760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189728 predicted 526
2 SASI_Hs01_00189729 predicted 1347
3 SASI_Hs01_00189731 predicted 1238
4 SASI_Hs01_00189732 predicted 708
5 SASI_Hs01_00189733 predicted 1270
6 SASI_Hs01_00189735 predicted 252
7 SASI_Hs01_00189736 predicted 332
8 SASI_Hs01_00189737 predicted 759
9 SASI_Hs02_00344118 predicted 1353
10 SASI_Hs02_00344119 predicted 1327
11 SASI_Hs01_00189730 predicted 763
12 SASI_Hs01_00189734 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075330 predicted 1275
2 SASI_Rn01_00075331 predicted 483
3 SASI_Rn01_00075332 predicted 596
4 SASI_Rn01_00075333 predicted 409
5 SASI_Rn01_00075334 predicted 1267
6 SASI_Rn01_00075335 predicted 707
7 SASI_Rn02_00260011 predicted 641
8 SASI_Rn01_00075336 predicted 505
9 SASI_Rn01_00075337 predicted 1236
10 SASI_Rn01_00075338 predicted 369
11 SASI_Rn01_00075339 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149437 predicted 374
2 SASI_Mm01_00149438 predicted 375
3 SASI_Mm01_00149439 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013760
VALIDATED
DNAJB9 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1241s21c1
Sequence:CCGGGCCCTGACTTGGGTTACTAAACTCGAGTTTAGTAACCCAAGTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-348s21c1
Sequence:CCGGTTGCAGAAGCGTATGAAACACCTCGAGGTGTTTCATACGCTTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-989s21c1
Sequence:CCGGGCTAGTAGACAACTGTAATTTCTCGAGAAATTACAGTTGTCTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013760.4-1129s21c1
Sequence:CCGGCCCGACACATACTTAACAATTCTCGAGAATTGTTAAGTATGTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-691s21c1
Sequence:CCGGCAATCGACACACAGTACAGACCTCGAGGTCTGTACTGTGTGTCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1062s21c1
Sequence:CCGGTACCTGTCCTTTGGCTCATTTCTCGAGAAATGAGCCAAAGGACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-378s21c1
Sequence:CCGGCCAATAGTCGGAAAGAGTATGCTCGAGCATACTCTTTCCGACTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013760.2-1768s1c1
Sequence:CCGGGCGATATAAGTACACTTGGAACTCGAGTTCCAAGTGTACTTATATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-757s1c1
Sequence:CCGGCACTGATTGTTCAGGACAATACTCGAGTATTGTCCTGAACAATCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-244s1c1
Sequence:CCGGCTTTCACAAATTAGCCATGAACTCGAGTTCATGGCTAATTTGTGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-665s1c1
Sequence:CCGGCGACACACAGTACAGACTGAACTCGAGTTCAGTCTGTACTGTGTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-595s1c1
Sequence:CCGGCGGATTGTTTGATGATATGTTCTCGAGAACATATCATCAAACAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013760
VALIDATED
DNAJB9 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1241s21c1
Sequence:CCGGGCCCTGACTTGGGTTACTAAACTCGAGTTTAGTAACCCAAGTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-348s21c1
Sequence:CCGGTTGCAGAAGCGTATGAAACACCTCGAGGTGTTTCATACGCTTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-989s21c1
Sequence:CCGGGCTAGTAGACAACTGTAATTTCTCGAGAAATTACAGTTGTCTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013760.4-1129s21c1
Sequence:CCGGCCCGACACATACTTAACAATTCTCGAGAATTGTTAAGTATGTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-691s21c1
Sequence:CCGGCAATCGACACACAGTACAGACCTCGAGGTCTGTACTGTGTGTCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1062s21c1
Sequence:CCGGTACCTGTCCTTTGGCTCATTTCTCGAGAAATGAGCCAAAGGACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-378s21c1
Sequence:CCGGCCAATAGTCGGAAAGAGTATGCTCGAGCATACTCTTTCCGACTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013760.2-1768s1c1
Sequence:CCGGGCGATATAAGTACACTTGGAACTCGAGTTCCAAGTGTACTTATATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-757s1c1
Sequence:CCGGCACTGATTGTTCAGGACAATACTCGAGTATTGTCCTGAACAATCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-244s1c1
Sequence:CCGGCTTTCACAAATTAGCCATGAACTCGAGTTCATGGCTAATTTGTGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-665s1c1
Sequence:CCGGCGACACACAGTACAGACTGAACTCGAGTTCAGTCTGTACTGTGTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-595s1c1
Sequence:CCGGCGGATTGTTTGATGATATGTTCTCGAGAACATATCATCAAACAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013760
VALIDATED
DNAJB9 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1241s21c1
Sequence:CCGGGCCCTGACTTGGGTTACTAAACTCGAGTTTAGTAACCCAAGTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-348s21c1
Sequence:CCGGTTGCAGAAGCGTATGAAACACCTCGAGGTGTTTCATACGCTTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-989s21c1
Sequence:CCGGGCTAGTAGACAACTGTAATTTCTCGAGAAATTACAGTTGTCTACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013760.4-1129s21c1
Sequence:CCGGCCCGACACATACTTAACAATTCTCGAGAATTGTTAAGTATGTGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-691s21c1
Sequence:CCGGCAATCGACACACAGTACAGACCTCGAGGTCTGTACTGTGTGTCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-1062s21c1
Sequence:CCGGTACCTGTCCTTTGGCTCATTTCTCGAGAAATGAGCCAAAGGACAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013760.4-378s21c1
Sequence:CCGGCCAATAGTCGGAAAGAGTATGCTCGAGCATACTCTTTCCGACTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013760.2-1768s1c1
Sequence:CCGGGCGATATAAGTACACTTGGAACTCGAGTTCCAAGTGTACTTATATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-757s1c1
Sequence:CCGGCACTGATTGTTCAGGACAATACTCGAGTATTGTCCTGAACAATCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-244s1c1
Sequence:CCGGCTTTCACAAATTAGCCATGAACTCGAGTTCATGGCTAATTTGTGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013760.2-665s1c1
Sequence:CCGGCGACACACAGTACAGACTGAACTCGAGTTCAGTCTGTACTGTGTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013760.2-595s1c1
Sequence:CCGGCGGATTGTTTGATGATATGTTCTCGAGAACATATCATCAAACAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012328
DNAJB9 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012328.1-1140s1c1
Sequence:CCGGGCTCACTAATATCACCAGTATCTCGAGATACTGGTGATATTAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-433s1c1
Sequence:CCGGCTCAGATGCTAATAGACGAAACTCGAGTTTCGTCTATTAGCATCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-524s1c1
Sequence:CCGGGAGCAGTCATTTAACTTCAATCTCGAGATTGAAGTTAAATGACTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-648s1c1
Sequence:CCGGCCAGTAGACAAAGGCATCATTCTCGAGAATGATGCCTTTGTCTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-831s1c1
Sequence:CCGGGAGGAAATATGGTTACTACATCTCGAGATGTAGTAACCATATTTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012328
DNAJB9 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012328.1-1140s1c1
Sequence:CCGGGCTCACTAATATCACCAGTATCTCGAGATACTGGTGATATTAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-433s1c1
Sequence:CCGGCTCAGATGCTAATAGACGAAACTCGAGTTTCGTCTATTAGCATCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-524s1c1
Sequence:CCGGGAGCAGTCATTTAACTTCAATCTCGAGATTGAAGTTAAATGACTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-648s1c1
Sequence:CCGGCCAGTAGACAAAGGCATCATTCTCGAGAATGATGCCTTTGTCTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-831s1c1
Sequence:CCGGGAGGAAATATGGTTACTACATCTCGAGATGTAGTAACCATATTTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012328
DNAJB9 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012328.1-1140s1c1
Sequence:CCGGGCTCACTAATATCACCAGTATCTCGAGATACTGGTGATATTAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-433s1c1
Sequence:CCGGCTCAGATGCTAATAGACGAAACTCGAGTTTCGTCTATTAGCATCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-524s1c1
Sequence:CCGGGAGCAGTCATTTAACTTCAATCTCGAGATTGAAGTTAAATGACTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-648s1c1
Sequence:CCGGCCAGTAGACAAAGGCATCATTCTCGAGAATGATGCCTTTGTCTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012328.1-831s1c1
Sequence:CCGGGAGGAAATATGGTTACTACATCTCGAGATGTAGTAACCATATTTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)