EMAIL THIS PAGE TO A FRIEND

DNAJC10

DnaJ (Hsp40) homolog, subfamily C, member 10

100 Gene Product Result for
Synonyms: ERdj5 JPDI MTHr PDIA19
Gene ID:
Human(54431) Summary: This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Mouse(66861) DnaJ (Hsp40) homolog, subfamily C, member 10
Rat(295690) DnaJ (Hsp40) homolog, subfamily C, member 10
naked mole-rat(101714043) DnaJ (Hsp40) homolog, subfamily C, member 10
domestic guinea pig(100716408) DnaJ (Hsp40) homolog, subfamily C, member 10
sheep(101118669) DnaJ (Hsp40) homolog, subfamily C, member 10
Domestic Rabbit(100359290) DnaJ (Hsp40) homolog, subfamily C, member 10
Zebrafish(557858) DnaJ (Hsp40) homolog, subfamily C, member 10
chicken(424115) DnaJ (Hsp40) homolog, subfamily C, member 10
domestic cat(101083533) DnaJ (Hsp40) homolog, subfamily C, member 10
cow(613403) DnaJ (Hsp40) homolog, subfamily C, member 10
dog(478826) DnaJ (Hsp40) homolog, subfamily C, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018981 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018981 Rosetta Predictions human pricing
NM_001106486 Rosetta Predictions rat pricing
NM_024181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352478 predicted 842
2 SASI_Hs01_00128659 predicted 651
3 SASI_Hs01_00128660 predicted 978
4 SASI_Hs01_00128661 predicted 921
5 SASI_Hs02_00352479 predicted 1212
6 SASI_Hs01_00128662 predicted 745
7 SASI_Hs01_00128663 predicted 2130
8 SASI_Hs01_00128664 predicted 1172
9 SASI_Hs01_00128665 predicted 620
10 SASI_Hs01_00128666 predicted 2234
11 SASI_Hs01_00128658 predicted 592
12 SASI_Hs01_00128667 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219438 predicted 266
2 SASI_Rn02_00219439 predicted 496
3 SASI_Rn02_00219440 predicted 770
4 SASI_Rn02_00219441 predicted 692
5 SASI_Rn02_00219442 predicted 1099
6 SASI_Rn02_00219443 predicted 1017
7 SASI_Rn02_00219444 predicted 1063
8 SASI_Rn02_00219445 predicted 1932
9 SASI_Rn02_00219446 predicted 370
10 SASI_Rn02_00219447 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057228 predicted 919
2 SASI_Mm01_00057229 predicted 723
3 SASI_Mm01_00057230 predicted 650
4 SASI_Mm01_00057231 predicted 1997
5 SASI_Mm01_00057232 predicted 1127
6 SASI_Mm01_00057234 predicted 2296
7 SASI_Mm01_00057235 predicted 1000
8 SASI_Mm01_00057236 predicted 2407
9 SASI_Mm02_00327501 predicted 495
10 SASI_Mm02_00327502 predicted 733
11 SASI_Mm01_00057227 predicted 2125
12 SASI_Mm01_00057233 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024181
VALIDATED
DNAJC10 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1124s21c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1440s21c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024181.2-3340s21c1
Sequence:CCGGATTCTGTCTATGACCATATATCTCGAGATATATGGTCATAGACAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-841s21c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1117s1c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1116s1c1
Sequence:CCGGGCCACTTTGAATGACAGGGAACTCGAGTTCCCTGTCATTCAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024181.1-2196s1c1
Sequence:CCGGCCTCAGACTTTCAGGAATGAACTCGAGTTCATTCCTGAAAGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-801s1c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-518s1c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024181
VALIDATED
DNAJC10 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1124s21c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1440s21c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024181.2-3340s21c1
Sequence:CCGGATTCTGTCTATGACCATATATCTCGAGATATATGGTCATAGACAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-841s21c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1117s1c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1116s1c1
Sequence:CCGGGCCACTTTGAATGACAGGGAACTCGAGTTCCCTGTCATTCAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024181.1-2196s1c1
Sequence:CCGGCCTCAGACTTTCAGGAATGAACTCGAGTTCATTCCTGAAAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-801s1c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-518s1c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024181
VALIDATED
DNAJC10 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1124s21c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-1440s21c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024181.2-3340s21c1
Sequence:CCGGATTCTGTCTATGACCATATATCTCGAGATATATGGTCATAGACAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024181.2-841s21c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1117s1c1
Sequence:CCGGCCACTTTGAATGACAGGGAAACTCGAGTTTCCCTGTCATTCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-1116s1c1
Sequence:CCGGGCCACTTTGAATGACAGGGAACTCGAGTTCCCTGTCATTCAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024181.1-2196s1c1
Sequence:CCGGCCTCAGACTTTCAGGAATGAACTCGAGTTCATTCCTGAAAGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-801s1c1
Sequence:CCGGGCAGTGAAGTACAATGGAGATCTCGAGATCTCCATTGTACTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024181.1-518s1c1
Sequence:CCGGCCGTTACGATTTCGGTATTTACTCGAGTAAATACCGAAATCGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018981
VALIDATED
DNAJC10 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-590s21c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018981.1-1631s21c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-1865s21c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-745s21c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-2221s1c1
Sequence:CCGGCCGGACATTAACTGGACTGATCTCGAGATCAGTCCAGTTAATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1865s1c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1631s1c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-590s1c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-745s1c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018981
VALIDATED
DNAJC10 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-590s21c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018981.1-1631s21c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-1865s21c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-745s21c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-2221s1c1
Sequence:CCGGCCGGACATTAACTGGACTGATCTCGAGATCAGTCCAGTTAATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1865s1c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1631s1c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-590s1c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-745s1c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018981
VALIDATED
DNAJC10 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-590s21c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018981.1-1631s21c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-1865s21c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018981.1-745s21c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-2221s1c1
Sequence:CCGGCCGGACATTAACTGGACTGATCTCGAGATCAGTCCAGTTAATGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1865s1c1
Sequence:CCGGCGAGCTTTACTACCAGAGTTACTCGAGTAACTCTGGTAGTAAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-1631s1c1
Sequence:CCGGGCACCAGACATCTGTAGTAATCTCGAGATTACTACAGATGTCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-590s1c1
Sequence:CCGGGCATTGAAGTTACATCCTGATCTCGAGATCAGGATGTAACTTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018981.1-745s1c1
Sequence:CCGGCCAGTATGAAAGCTGGAACTACTCGAGTAGTTCCAGCTTTCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)