EMAIL THIS PAGE TO A FRIEND

DNAJC11

DnaJ (Hsp40) homolog, subfamily C, member 11

48 Gene Product Result for
Synonyms: dJ126A5.1
Gene ID:
Mouse(230935) DnaJ (Hsp40) homolog, subfamily C, member 11
Rat(362666) DnaJ (Hsp40) homolog, subfamily C, member 11
Zebrafish(322953) DnaJ (Hsp40) homolog, subfamily C, member 11
cow(508137) DnaJ (Hsp40) homolog, subfamily C, member 11
Horse(100058962) DnaJ (Hsp40) homolog, subfamily C, member 11
domestic cat(101092624) DnaJ (Hsp40) homolog, subfamily C, member 11
dog(612784) DnaJ (Hsp40) homolog, subfamily C, member 11
chicken(428173) DnaJ (Hsp40) homolog, subfamily C, member 11
sheep(101120259) DnaJ (Hsp40) homolog, subfamily C, member 11
domestic guinea pig(100723460) DnaJ (Hsp40) homolog, subfamily C, member 11
naked mole-rat(101699176) DnaJ (Hsp40) homolog, subfamily C, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067711 MISSION® esiRNA esiRNA targeting mouse Dnajc11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018198 Rosetta Predictions human pricing
NM_001108694 Rosetta Predictions rat pricing
NM_172704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100412 predicted 1126
2 SASI_Hs01_00100413 predicted 703
3 SASI_Hs02_00351482 predicted 1120
4 SASI_Hs02_00351483 predicted 1121
5 SASI_Hs01_00100415 predicted 929
6 SASI_Hs02_00351484 predicted 1348
7 SASI_Hs01_00100416 predicted 681
8 SASI_Hs01_00100417 predicted 1377
9 SASI_Hs01_00100420 predicted 1401
10 SASI_Hs02_00351485 predicted 924
11 SASI_Hs01_00100411 predicted 1352
12 SASI_Hs01_00100414 predicted 1110
13 SASI_Hs01_00100418 predicted 1230
14 SASI_Hs01_00100419 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241155 predicted 698
2 SASI_Rn02_00241156 predicted 657
3 SASI_Rn02_00241157 predicted 1212
4 SASI_Rn02_00241158 predicted 1453
5 SASI_Rn02_00241159 predicted 716
6 SASI_Rn02_00241160 predicted 1220
7 SASI_Rn02_00241161 predicted 673
8 SASI_Rn02_00241162 predicted 900
9 SASI_Rn02_00241163 predicted 1606
10 SASI_Rn02_00241164 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344457 predicted 696
2 SASI_Mm02_00344458 predicted 724
3 SASI_Mm02_00344459 predicted 1634
4 SASI_Mm02_00344460 predicted 1425
5 SASI_Mm02_00344461 predicted 941
6 SASI_Mm02_00344462 predicted 883
7 SASI_Mm02_00344463 predicted 1459
8 SASI_Mm02_00344464 predicted 1752
9 SASI_Mm02_00344465 predicted 614
10 SASI_Mm02_00344466 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018198
VALIDATED
DNAJC11 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-2261s1c1
Sequence:CCGGGTTTGGAAATTAGTCGTCTTTCTCGAGAAAGACGACTAATTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018198.1-1363s1c1
Sequence:CCGGCGAAGGATAATTGAGGCAGAACTCGAGTTCTGCCTCAATTATCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2923s1c1
Sequence:CCGGCCAGCACTGGTATCTGAGTAACTCGAGTTACTCAGATACCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-316s1c1
Sequence:CCGGGCTGAAATTCGAGAGGAGTTTCTCGAGAAACTCCTCTCGAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-1227s1c1
Sequence:CCGGCCGTCTGATCATCAAACCATACTCGAGTATGGTTTGATGATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-181s1c1
Sequence:CCGGGAACGACTGTTTAACCTTGTTCTCGAGAACAAGGTTAAACAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2185s1c1
Sequence:CCGGCCTGCTGAAATATTACTGCTTCTCGAGAAGCAGTAATATTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018198.2-1734s21c1
Sequence:CCGGTTTCCTGGGAGTCTACAAATTCTCGAGAATTTGTAGACTCCCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-465s21c1
Sequence:CCGGGCAGTAGCTTTCCGCAGATTGCTCGAGCAATCTGCGGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-41s21c1
Sequence:CCGGCTGGACAATGAAGACTATTACCTCGAGGTAATAGTCTTCATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-1675s21c1
Sequence:CCGGGATCGATACAGATGGATAAACCTCGAGGTTTATCCATCTGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-601s21c1
Sequence:CCGGCTTTGCGCTCAGACGAGTAACCTCGAGGTTACTCGTCTGAGCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018198
VALIDATED
DNAJC11 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-2261s1c1
Sequence:CCGGGTTTGGAAATTAGTCGTCTTTCTCGAGAAAGACGACTAATTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018198.1-1363s1c1
Sequence:CCGGCGAAGGATAATTGAGGCAGAACTCGAGTTCTGCCTCAATTATCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2923s1c1
Sequence:CCGGCCAGCACTGGTATCTGAGTAACTCGAGTTACTCAGATACCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-316s1c1
Sequence:CCGGGCTGAAATTCGAGAGGAGTTTCTCGAGAAACTCCTCTCGAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-1227s1c1
Sequence:CCGGCCGTCTGATCATCAAACCATACTCGAGTATGGTTTGATGATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-181s1c1
Sequence:CCGGGAACGACTGTTTAACCTTGTTCTCGAGAACAAGGTTAAACAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2185s1c1
Sequence:CCGGCCTGCTGAAATATTACTGCTTCTCGAGAAGCAGTAATATTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018198.2-1734s21c1
Sequence:CCGGTTTCCTGGGAGTCTACAAATTCTCGAGAATTTGTAGACTCCCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-465s21c1
Sequence:CCGGGCAGTAGCTTTCCGCAGATTGCTCGAGCAATCTGCGGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-41s21c1
Sequence:CCGGCTGGACAATGAAGACTATTACCTCGAGGTAATAGTCTTCATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-1675s21c1
Sequence:CCGGGATCGATACAGATGGATAAACCTCGAGGTTTATCCATCTGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-601s21c1
Sequence:CCGGCTTTGCGCTCAGACGAGTAACCTCGAGGTTACTCGTCTGAGCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018198
VALIDATED
DNAJC11 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-2261s1c1
Sequence:CCGGGTTTGGAAATTAGTCGTCTTTCTCGAGAAAGACGACTAATTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018198.1-1363s1c1
Sequence:CCGGCGAAGGATAATTGAGGCAGAACTCGAGTTCTGCCTCAATTATCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2923s1c1
Sequence:CCGGCCAGCACTGGTATCTGAGTAACTCGAGTTACTCAGATACCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-316s1c1
Sequence:CCGGGCTGAAATTCGAGAGGAGTTTCTCGAGAAACTCCTCTCGAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-1227s1c1
Sequence:CCGGCCGTCTGATCATCAAACCATACTCGAGTATGGTTTGATGATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018198.1-181s1c1
Sequence:CCGGGAACGACTGTTTAACCTTGTTCTCGAGAACAAGGTTAAACAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018198.1-2185s1c1
Sequence:CCGGCCTGCTGAAATATTACTGCTTCTCGAGAAGCAGTAATATTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018198.2-1734s21c1
Sequence:CCGGTTTCCTGGGAGTCTACAAATTCTCGAGAATTTGTAGACTCCCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-465s21c1
Sequence:CCGGGCAGTAGCTTTCCGCAGATTGCTCGAGCAATCTGCGGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-41s21c1
Sequence:CCGGCTGGACAATGAAGACTATTACCTCGAGGTAATAGTCTTCATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-1675s21c1
Sequence:CCGGGATCGATACAGATGGATAAACCTCGAGGTTTATCCATCTGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018198.2-601s21c1
Sequence:CCGGCTTTGCGCTCAGACGAGTAACCTCGAGGTTACTCGTCTGAGCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172704
VALIDATED
DNAJC11 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172704.1-2827s1c1
Sequence:CCGGGCAGACATAATGCAAGCCAAACTCGAGTTTGGCTTGCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-52s1c1
Sequence:CCGGGCTGGACAATGAAGACTATTACTCGAGTAATAGTCTTCATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-487s1c1
Sequence:CCGGCCCGCAGATTGAGATTAATAACTCGAGTTATTAATCTCAATCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172704.1-723s1c1
Sequence:CCGGCAAGATGCTTTGTGACGACAACTCGAGTTGTCGTCACAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-446s1c1
Sequence:CCGGCGTTATGATGAGGAATATGAACTCGAGTTCATATTCCTCATCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-1694s21c1
Sequence:CCGGGAATCGACACAGACGGGTAAACTCGAGTTTACCCGTCTGTGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-943s21c1
Sequence:CCGGTCCTTTGCACTCATCAGTTATCTCGAGATAACTGATGAGTGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172704.3-1830s21c1
Sequence:CCGGGGGCACTGTATCAATTATGTGCTCGAGCACATAATTGATACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-703s21c1
Sequence:CCGGGGTCTCAAGCTGTTCCGTAATCTCGAGATTACGGAACAGCTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172704
VALIDATED
DNAJC11 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172704.1-2827s1c1
Sequence:CCGGGCAGACATAATGCAAGCCAAACTCGAGTTTGGCTTGCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-52s1c1
Sequence:CCGGGCTGGACAATGAAGACTATTACTCGAGTAATAGTCTTCATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-487s1c1
Sequence:CCGGCCCGCAGATTGAGATTAATAACTCGAGTTATTAATCTCAATCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172704.1-723s1c1
Sequence:CCGGCAAGATGCTTTGTGACGACAACTCGAGTTGTCGTCACAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-446s1c1
Sequence:CCGGCGTTATGATGAGGAATATGAACTCGAGTTCATATTCCTCATCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-1694s21c1
Sequence:CCGGGAATCGACACAGACGGGTAAACTCGAGTTTACCCGTCTGTGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-943s21c1
Sequence:CCGGTCCTTTGCACTCATCAGTTATCTCGAGATAACTGATGAGTGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172704.3-1830s21c1
Sequence:CCGGGGGCACTGTATCAATTATGTGCTCGAGCACATAATTGATACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-703s21c1
Sequence:CCGGGGTCTCAAGCTGTTCCGTAATCTCGAGATTACGGAACAGCTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172704
VALIDATED
DNAJC11 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172704.1-2827s1c1
Sequence:CCGGGCAGACATAATGCAAGCCAAACTCGAGTTTGGCTTGCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-52s1c1
Sequence:CCGGGCTGGACAATGAAGACTATTACTCGAGTAATAGTCTTCATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-487s1c1
Sequence:CCGGCCCGCAGATTGAGATTAATAACTCGAGTTATTAATCTCAATCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172704.1-723s1c1
Sequence:CCGGCAAGATGCTTTGTGACGACAACTCGAGTTGTCGTCACAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172704.1-446s1c1
Sequence:CCGGCGTTATGATGAGGAATATGAACTCGAGTTCATATTCCTCATCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-1694s21c1
Sequence:CCGGGAATCGACACAGACGGGTAAACTCGAGTTTACCCGTCTGTGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-943s21c1
Sequence:CCGGTCCTTTGCACTCATCAGTTATCTCGAGATAACTGATGAGTGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172704.3-1830s21c1
Sequence:CCGGGGGCACTGTATCAATTATGTGCTCGAGCACATAATTGATACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172704.3-703s21c1
Sequence:CCGGGGTCTCAAGCTGTTCCGTAATCTCGAGATTACGGAACAGCTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks